Incidental Mutation 'R5222:Tcf7l2'
ID 402396
Institutional Source Beutler Lab
Gene Symbol Tcf7l2
Ensembl Gene ENSMUSG00000024985
Gene Name transcription factor 7 like 2, T cell specific, HMG box
Synonyms Tcf4, TCF4E, Tcf-4, mTcf-4B, mTcf-4E, TCF4B
MMRRC Submission 042795-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5222 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 55730252-55922086 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55887044 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 19 (Q19R)
Ref Sequence ENSEMBL: ENSMUSP00000119759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041717] [ENSMUST00000061496] [ENSMUST00000111646] [ENSMUST00000111649] [ENSMUST00000111651] [ENSMUST00000111652] [ENSMUST00000111653] [ENSMUST00000111654] [ENSMUST00000111656] [ENSMUST00000148666] [ENSMUST00000111657] [ENSMUST00000111659] [ENSMUST00000142291] [ENSMUST00000111658] [ENSMUST00000153888] [ENSMUST00000111662]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041717
SMART Domains Protein: ENSMUSP00000042950
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061496
SMART Domains Protein: ENSMUSP00000050081
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111646
SMART Domains Protein: ENSMUSP00000107273
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 2.4e-37 PFAM
HMG 166 236 1.16e-22 SMART
low complexity region 242 250 N/A INTRINSIC
c-clamp 278 298 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111649
SMART Domains Protein: ENSMUSP00000107276
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111651
SMART Domains Protein: ENSMUSP00000107278
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 284 2.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111652
SMART Domains Protein: ENSMUSP00000107279
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 9.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111653
SMART Domains Protein: ENSMUSP00000107280
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111654
SMART Domains Protein: ENSMUSP00000107281
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.2e-93 PFAM
HMG 345 415 1.16e-22 SMART
low complexity region 421 429 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111656
SMART Domains Protein: ENSMUSP00000107283
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 458 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148666
AA Change: Q19R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119759
Gene: ENSMUSG00000024985
AA Change: Q19R

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 10 106 5.7e-39 PFAM
HMG 196 265 1.02e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126434
Predicted Effect probably benign
Transcript: ENSMUST00000111657
SMART Domains Protein: ENSMUSP00000107284
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 468 2.08e-14 SMART
low complexity region 471 498 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127233
SMART Domains Protein: ENSMUSP00000123428
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 229 9.3e-98 PFAM
HMG 319 389 1.16e-22 SMART
low complexity region 395 403 N/A INTRINSIC
c-clamp 414 434 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111659
SMART Domains Protein: ENSMUSP00000107287
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-96 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142291
SMART Domains Protein: ENSMUSP00000118042
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 5e-40 PFAM
SCOP:d1j46a_ 164 178 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111658
SMART Domains Protein: ENSMUSP00000107286
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.5e-93 PFAM
HMG 350 420 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153888
SMART Domains Protein: ENSMUSP00000118661
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 217 1.2e-64 PFAM
HMG 307 377 1.16e-22 SMART
low complexity region 383 391 N/A INTRINSIC
c-clamp 402 432 5.29e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111662
SMART Domains Protein: ENSMUSP00000107291
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-103 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 421 442 1.23e-2 SMART
c-clamp 446 476 1.35e-13 SMART
low complexity region 479 506 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit intestinal epithelia abnormalities and die shortly after birth. Mice heterozygous for some mutations display abnormalities in glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 159,872,178 (GRCm39) noncoding transcript Het
Acad11 G A 9: 103,974,576 (GRCm39) A515T probably damaging Het
Angpt1 T C 15: 42,539,730 (GRCm39) Y43C probably damaging Het
Arhgef33 A G 17: 80,644,743 (GRCm39) Y24C probably damaging Het
Cd40 G C 2: 164,908,464 (GRCm39) S180T probably benign Het
Cenpc1 A T 5: 86,185,606 (GRCm39) S302T possibly damaging Het
Cit C A 5: 116,090,602 (GRCm39) T932K probably benign Het
Col19a1 A C 1: 24,598,721 (GRCm39) probably null Het
Dapk3 A G 10: 81,028,294 (GRCm39) E288G probably damaging Het
Ddx60 T C 8: 62,437,192 (GRCm39) F1002S probably damaging Het
Dgke G T 11: 88,941,220 (GRCm39) T321K probably benign Het
Ebf2 T G 14: 67,551,043 (GRCm39) probably benign Het
Enpp7 A G 11: 118,881,788 (GRCm39) D311G probably benign Het
Epm2a A G 10: 11,324,493 (GRCm39) E194G probably damaging Het
Esf1 A G 2: 140,000,503 (GRCm39) Y428H possibly damaging Het
Esyt2 T C 12: 116,282,446 (GRCm39) F132S probably damaging Het
Gm5455 T C 13: 110,441,494 (GRCm39) noncoding transcript Het
Gria1 T A 11: 57,080,623 (GRCm39) V202E probably benign Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Mark1 A T 1: 184,660,288 (GRCm39) F123I probably damaging Het
Nectin4 T A 1: 171,212,825 (GRCm39) probably null Het
Obscn T A 11: 58,934,971 (GRCm39) T5220S possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2l13 A C 16: 19,305,680 (GRCm39) I31L probably benign Het
Or2p2 T A 13: 21,256,739 (GRCm39) H244L probably damaging Het
Pdcd1 A T 1: 93,980,175 (GRCm39) V14E probably damaging Het
Pmel A G 10: 128,554,853 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,362 (GRCm39) I454F possibly damaging Het
Prrx1 C T 1: 163,089,542 (GRCm39) R95Q probably damaging Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Ptprq A G 10: 107,498,425 (GRCm39) I884T probably damaging Het
Rad17 G A 13: 100,770,399 (GRCm39) T216I possibly damaging Het
Rif1 T C 2: 51,967,032 (GRCm39) I107T probably benign Het
Rpp14 T C 14: 8,087,513 (GRCm38) L69P probably damaging Het
Rtel1 G T 2: 180,988,776 (GRCm39) probably benign Het
Sap130 C T 18: 31,799,756 (GRCm39) T362M probably damaging Het
Scn11a A G 9: 119,644,268 (GRCm39) probably null Het
Sec31a G T 5: 100,530,754 (GRCm39) T243N probably benign Het
Slc5a9 T A 4: 111,755,808 (GRCm39) H30L possibly damaging Het
Slco6b1 T A 1: 96,925,216 (GRCm39) noncoding transcript Het
Smarca4 A G 9: 21,567,002 (GRCm39) D694G probably benign Het
Spaca6 A G 17: 18,058,367 (GRCm39) T213A probably benign Het
Tagap C A 17: 8,152,473 (GRCm39) Q553K possibly damaging Het
Tagap A T 17: 8,152,474 (GRCm39) Q553L possibly damaging Het
Ttn A G 2: 76,709,197 (GRCm39) probably benign Het
Ubr7 A T 12: 102,741,964 (GRCm39) R399S probably benign Het
Uspl1 C A 5: 149,150,911 (GRCm39) Q690K possibly damaging Het
Vps8 T A 16: 21,400,298 (GRCm39) Y853* probably null Het
Vrk3 A T 7: 44,409,220 (GRCm39) Q129L possibly damaging Het
Wapl T A 14: 34,458,642 (GRCm39) C901* probably null Het
Other mutations in Tcf7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Tcf7l2 APN 19 55,905,853 (GRCm39) missense probably damaging 1.00
IGL01013:Tcf7l2 APN 19 55,908,059 (GRCm39) splice site probably benign
IGL02871:Tcf7l2 APN 19 55,907,429 (GRCm39) missense probably damaging 1.00
banned UTSW 19 55,919,864 (GRCm39) critical splice acceptor site probably null
Notable UTSW 19 55,915,172 (GRCm39) missense unknown
PIT4468001:Tcf7l2 UTSW 19 55,730,820 (GRCm39) missense probably damaging 1.00
R0927:Tcf7l2 UTSW 19 55,907,387 (GRCm39) missense probably damaging 1.00
R1078:Tcf7l2 UTSW 19 55,731,627 (GRCm39) missense probably benign 0.19
R4580:Tcf7l2 UTSW 19 55,907,468 (GRCm39) missense probably damaging 1.00
R4721:Tcf7l2 UTSW 19 55,919,886 (GRCm39) missense possibly damaging 0.89
R4814:Tcf7l2 UTSW 19 55,912,504 (GRCm39) nonsense probably null
R4957:Tcf7l2 UTSW 19 55,919,864 (GRCm39) critical splice acceptor site probably null
R5484:Tcf7l2 UTSW 19 55,907,940 (GRCm39) splice site probably null
R5808:Tcf7l2 UTSW 19 55,896,973 (GRCm39) missense probably damaging 1.00
R5914:Tcf7l2 UTSW 19 55,886,992 (GRCm39) missense probably benign 0.00
R6077:Tcf7l2 UTSW 19 55,905,868 (GRCm39) nonsense probably null
R6116:Tcf7l2 UTSW 19 55,907,446 (GRCm39) missense probably damaging 1.00
R6861:Tcf7l2 UTSW 19 55,730,955 (GRCm39) missense probably damaging 1.00
R6970:Tcf7l2 UTSW 19 55,743,480 (GRCm39) missense probably benign 0.44
R7009:Tcf7l2 UTSW 19 55,883,165 (GRCm39) critical splice donor site probably null
R7382:Tcf7l2 UTSW 19 55,915,172 (GRCm39) missense unknown
R7669:Tcf7l2 UTSW 19 55,912,975 (GRCm39) nonsense probably null
R7761:Tcf7l2 UTSW 19 55,914,468 (GRCm39) missense probably damaging 1.00
R7823:Tcf7l2 UTSW 19 55,731,521 (GRCm39) missense possibly damaging 0.73
R7952:Tcf7l2 UTSW 19 55,886,989 (GRCm39) start codon destroyed probably benign 0.00
R8753:Tcf7l2 UTSW 19 55,920,195 (GRCm39) missense possibly damaging 0.60
R9333:Tcf7l2 UTSW 19 55,919,928 (GRCm39) nonsense probably null
R9342:Tcf7l2 UTSW 19 55,731,517 (GRCm39) missense probably benign
R9395:Tcf7l2 UTSW 19 55,920,200 (GRCm39) nonsense probably null
R9610:Tcf7l2 UTSW 19 55,899,038 (GRCm39) missense probably null 1.00
R9611:Tcf7l2 UTSW 19 55,899,038 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCATCTTGAAGGTACAGAG -3'
(R):5'- CTGCACTGACCATTCATTCTGG -3'

Sequencing Primer
(F):5'- GCTATTATGTACCCCAGGGA -3'
(R):5'- GCACTGACCATTCATTCTGGTTTTG -3'
Posted On 2016-07-22