Incidental Mutation 'R0415:Vmn2r74'
ID 40240
Institutional Source Beutler Lab
Gene Symbol Vmn2r74
Ensembl Gene ENSMUSG00000090774
Gene Name vomeronasal 2, receptor 74
Synonyms EG546980
MMRRC Submission 038617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R0415 (G1)
Quality Score 170
Status Validated
Chromosome 7
Chromosomal Location 85601075-85610690 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 85610618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 25 (C25G)
Ref Sequence ENSEMBL: ENSMUSP00000126917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166355]
AlphaFold E9PW21
Predicted Effect probably damaging
Transcript: ENSMUST00000166355
AA Change: C25G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126917
Gene: ENSMUSG00000090774
AA Change: C25G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 7.3e-28 PFAM
Pfam:NCD3G 510 562 4.7e-20 PFAM
Pfam:7tm_3 592 830 1.3e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 24,036,048 (GRCm39) noncoding transcript Het
Acox2 A G 14: 8,243,835 (GRCm38) probably benign Het
Adgb T C 10: 10,306,811 (GRCm39) probably null Het
Adgra3 C A 5: 50,119,099 (GRCm39) probably benign Het
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ahnak A G 19: 8,990,235 (GRCm39) probably benign Het
Anapc2 A G 2: 25,168,337 (GRCm39) T159A probably damaging Het
Arfgef3 A G 10: 18,488,875 (GRCm39) probably benign Het
Atf7ip C T 6: 136,537,010 (GRCm39) S81L possibly damaging Het
Cacna1i A G 15: 80,253,031 (GRCm39) probably benign Het
Camk1 A T 6: 113,318,852 (GRCm39) Y20* probably null Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
Cd109 T A 9: 78,619,897 (GRCm39) S1380T probably benign Het
Cfap57 A T 4: 118,426,628 (GRCm39) L1107Q possibly damaging Het
Col6a4 C T 9: 105,952,279 (GRCm39) V540I probably damaging Het
Cst9 T A 2: 148,680,362 (GRCm39) probably benign Het
Cul5 C T 9: 53,578,370 (GRCm39) V73I probably benign Het
Cxcl16 T A 11: 70,349,574 (GRCm39) K84* probably null Het
Cyp2c29 T C 19: 39,317,539 (GRCm39) probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dip2c C T 13: 9,618,325 (GRCm39) probably benign Het
Dis3 A T 14: 99,324,892 (GRCm39) I513N probably damaging Het
Dnajc16 A T 4: 141,516,359 (GRCm39) L3* probably null Het
Dop1a T A 9: 86,388,555 (GRCm39) L480M probably damaging Het
Eml6 A G 11: 29,699,392 (GRCm39) V1787A possibly damaging Het
Etnk1 A G 6: 143,126,500 (GRCm39) N115S probably damaging Het
Fryl T C 5: 73,255,757 (GRCm39) Y758C probably damaging Het
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Ggnbp2 A C 11: 84,724,051 (GRCm39) probably benign Het
Gm7137 A G 10: 77,624,007 (GRCm39) probably benign Het
Gstm2 T A 3: 107,891,322 (GRCm39) Q132L probably benign Het
Habp2 T C 19: 56,306,149 (GRCm39) probably benign Het
Hectd2 T C 19: 36,562,284 (GRCm39) probably benign Het
Htr6 A G 4: 138,789,392 (GRCm39) I291T possibly damaging Het
Ighg2c T C 12: 113,251,530 (GRCm39) D199G unknown Het
Itih2 A G 2: 10,110,426 (GRCm39) probably benign Het
Kcnab2 A G 4: 152,479,593 (GRCm39) F248S probably benign Het
Kcnc4 T C 3: 107,352,749 (GRCm39) K610E probably damaging Het
Kcnk16 T A 14: 20,313,043 (GRCm39) probably null Het
Kndc1 C T 7: 139,510,037 (GRCm39) T1293I probably damaging Het
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Lrrc8d T C 5: 105,959,731 (GRCm39) L47P probably damaging Het
Lyset T A 12: 102,711,135 (GRCm39) Y119* probably null Het
Lyst T C 13: 13,886,195 (GRCm39) probably benign Het
Macrod2 G A 2: 142,052,065 (GRCm39) probably null Het
Mical2 C T 7: 111,980,235 (GRCm39) R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,759,576 (GRCm39) probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nup205 T C 6: 35,191,569 (GRCm39) probably benign Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or51e2 C T 7: 102,391,294 (GRCm39) M305I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Or8c15 A T 9: 38,121,269 (GRCm39) M305L probably benign Het
Or8g2 A G 9: 39,821,279 (GRCm39) Y60C probably damaging Het
Pard3 G A 8: 128,337,047 (GRCm39) G1221D probably damaging Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Pcsk6 C T 7: 65,683,622 (GRCm39) R746C probably damaging Het
Pif1 G A 9: 65,495,333 (GRCm39) C81Y probably benign Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plcd4 C A 1: 74,591,256 (GRCm39) S217Y probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Het
Polr2k A G 15: 36,175,602 (GRCm39) Y45C probably damaging Het
Prex1 A G 2: 166,428,619 (GRCm39) probably benign Het
Pth2r A G 1: 65,427,598 (GRCm39) M424V probably benign Het
Pygm A G 19: 6,441,396 (GRCm39) R464G probably benign Het
Rad51c A G 11: 87,288,481 (GRCm39) L234P probably damaging Het
Rnf145 A G 11: 44,415,965 (GRCm39) Y60C probably damaging Het
Rnf167 T C 11: 70,540,525 (GRCm39) I135T probably damaging Het
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ro60 G T 1: 143,635,813 (GRCm39) N444K probably benign Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Het
Selenbp1 T C 3: 94,844,224 (GRCm39) V27A possibly damaging Het
Selenof T G 3: 144,283,453 (GRCm39) L14R probably damaging Het
Sfswap A T 5: 129,581,190 (GRCm39) D121V probably damaging Het
Slc25a34 C A 4: 141,347,780 (GRCm39) M300I possibly damaging Het
Slc34a3 T G 2: 25,119,122 (GRCm39) T583P probably benign Het
Slc66a3 C A 12: 17,047,711 (GRCm39) probably benign Het
Smg1 C A 7: 117,781,691 (GRCm39) A1199S probably benign Het
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Sptbn1 A C 11: 30,099,576 (GRCm39) N229K probably damaging Het
Sult2b1 A G 7: 45,379,516 (GRCm39) probably benign Het
Tas2r123 A T 6: 132,824,801 (GRCm39) M233L probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem132c A G 5: 127,640,769 (GRCm39) E980G probably damaging Het
Tmem247 G T 17: 87,229,750 (GRCm39) C197F probably damaging Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Het
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Ubr5 T C 15: 37,973,224 (GRCm39) T2626A probably damaging Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Het
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Het
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Xndc1 T C 7: 101,729,823 (GRCm39) probably benign Het
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Het
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Het
Zfp316 T A 5: 143,250,246 (GRCm39) T56S unknown Het
Zfp345 A G 2: 150,316,479 (GRCm39) probably benign Het
Other mutations in Vmn2r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Vmn2r74 APN 7 85,606,338 (GRCm39) missense probably benign 0.03
IGL00904:Vmn2r74 APN 7 85,606,788 (GRCm39) missense probably benign 0.05
IGL01285:Vmn2r74 APN 7 85,606,692 (GRCm39) missense possibly damaging 0.54
IGL01300:Vmn2r74 APN 7 85,606,414 (GRCm39) missense probably benign 0.00
IGL01410:Vmn2r74 APN 7 85,610,500 (GRCm39) missense possibly damaging 0.83
IGL01827:Vmn2r74 APN 7 85,606,800 (GRCm39) missense probably benign 0.00
IGL02094:Vmn2r74 APN 7 85,610,669 (GRCm39) missense probably benign 0.01
IGL02252:Vmn2r74 APN 7 85,606,531 (GRCm39) missense probably benign 0.41
IGL02349:Vmn2r74 APN 7 85,601,724 (GRCm39) missense probably damaging 0.99
IGL02438:Vmn2r74 APN 7 85,601,824 (GRCm39) missense probably damaging 0.98
IGL02554:Vmn2r74 APN 7 85,606,581 (GRCm39) missense probably benign 0.00
IGL03036:Vmn2r74 APN 7 85,601,900 (GRCm39) nonsense probably null
IGL03370:Vmn2r74 APN 7 85,607,265 (GRCm39) missense probably benign
R0115:Vmn2r74 UTSW 7 85,606,564 (GRCm39) missense probably benign 0.00
R0333:Vmn2r74 UTSW 7 85,601,491 (GRCm39) missense probably benign 0.06
R0571:Vmn2r74 UTSW 7 85,601,629 (GRCm39) missense probably damaging 1.00
R0626:Vmn2r74 UTSW 7 85,610,517 (GRCm39) nonsense probably null
R0659:Vmn2r74 UTSW 7 85,605,122 (GRCm39) splice site probably benign
R1202:Vmn2r74 UTSW 7 85,610,545 (GRCm39) missense possibly damaging 0.83
R1473:Vmn2r74 UTSW 7 85,610,618 (GRCm39) missense probably damaging 1.00
R1908:Vmn2r74 UTSW 7 85,601,650 (GRCm39) missense probably benign
R2079:Vmn2r74 UTSW 7 85,606,383 (GRCm39) missense probably benign 0.00
R2368:Vmn2r74 UTSW 7 85,610,522 (GRCm39) missense probably benign 0.39
R3782:Vmn2r74 UTSW 7 85,605,322 (GRCm39) missense probably benign 0.01
R3824:Vmn2r74 UTSW 7 85,607,466 (GRCm39) missense probably damaging 1.00
R3977:Vmn2r74 UTSW 7 85,607,345 (GRCm39) missense probably benign 0.01
R4182:Vmn2r74 UTSW 7 85,606,395 (GRCm39) missense possibly damaging 0.87
R4289:Vmn2r74 UTSW 7 85,606,562 (GRCm39) missense probably benign
R4294:Vmn2r74 UTSW 7 85,606,624 (GRCm39) missense probably benign 0.14
R4645:Vmn2r74 UTSW 7 85,606,317 (GRCm39) missense probably benign
R4646:Vmn2r74 UTSW 7 85,606,782 (GRCm39) missense probably benign 0.42
R4655:Vmn2r74 UTSW 7 85,610,555 (GRCm39) missense probably benign
R4901:Vmn2r74 UTSW 7 85,605,199 (GRCm39) nonsense probably null
R5532:Vmn2r74 UTSW 7 85,601,197 (GRCm39) missense probably benign 0.32
R5642:Vmn2r74 UTSW 7 85,606,588 (GRCm39) missense probably benign 0.00
R5913:Vmn2r74 UTSW 7 85,601,098 (GRCm39) missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85,601,098 (GRCm39) missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85,601,098 (GRCm39) missense probably damaging 0.98
R6039:Vmn2r74 UTSW 7 85,607,526 (GRCm39) critical splice acceptor site probably null
R6039:Vmn2r74 UTSW 7 85,607,526 (GRCm39) critical splice acceptor site probably null
R6170:Vmn2r74 UTSW 7 85,606,348 (GRCm39) missense probably benign 0.03
R6232:Vmn2r74 UTSW 7 85,607,498 (GRCm39) missense possibly damaging 0.82
R6238:Vmn2r74 UTSW 7 85,601,280 (GRCm39) missense probably damaging 1.00
R6255:Vmn2r74 UTSW 7 85,601,659 (GRCm39) missense possibly damaging 0.90
R6468:Vmn2r74 UTSW 7 85,610,599 (GRCm39) missense probably benign 0.34
R6732:Vmn2r74 UTSW 7 85,606,758 (GRCm39) missense probably damaging 1.00
R6816:Vmn2r74 UTSW 7 85,610,621 (GRCm39) nonsense probably null
R6836:Vmn2r74 UTSW 7 85,606,630 (GRCm39) missense probably benign 0.00
R6995:Vmn2r74 UTSW 7 85,606,860 (GRCm39) critical splice acceptor site probably null
R6995:Vmn2r74 UTSW 7 85,601,943 (GRCm39) missense probably benign 0.01
R7186:Vmn2r74 UTSW 7 85,601,150 (GRCm39) nonsense probably null
R7246:Vmn2r74 UTSW 7 85,605,173 (GRCm39) missense probably benign
R7374:Vmn2r74 UTSW 7 85,606,630 (GRCm39) missense probably benign 0.02
R7505:Vmn2r74 UTSW 7 85,606,279 (GRCm39) nonsense probably null
R7525:Vmn2r74 UTSW 7 85,610,510 (GRCm39) missense probably benign
R7569:Vmn2r74 UTSW 7 85,601,544 (GRCm39) missense probably damaging 0.99
R7644:Vmn2r74 UTSW 7 85,606,746 (GRCm39) missense probably benign 0.11
R7956:Vmn2r74 UTSW 7 85,605,166 (GRCm39) missense probably benign 0.09
R8119:Vmn2r74 UTSW 7 85,610,690 (GRCm39) start codon destroyed probably null 0.08
R8131:Vmn2r74 UTSW 7 85,601,943 (GRCm39) missense probably benign 0.01
R8147:Vmn2r74 UTSW 7 85,605,227 (GRCm39) nonsense probably null
R8181:Vmn2r74 UTSW 7 85,605,324 (GRCm39) missense probably damaging 1.00
R8184:Vmn2r74 UTSW 7 85,601,454 (GRCm39) missense probably benign 0.00
R8375:Vmn2r74 UTSW 7 85,601,914 (GRCm39) missense possibly damaging 0.64
R8948:Vmn2r74 UTSW 7 85,606,569 (GRCm39) missense probably damaging 1.00
R8950:Vmn2r74 UTSW 7 85,606,569 (GRCm39) missense probably damaging 1.00
R9033:Vmn2r74 UTSW 7 85,606,414 (GRCm39) missense probably benign
R9342:Vmn2r74 UTSW 7 85,606,624 (GRCm39) missense probably benign 0.14
R9578:Vmn2r74 UTSW 7 85,606,101 (GRCm39) missense probably benign 0.01
R9607:Vmn2r74 UTSW 7 85,610,619 (GRCm39) missense probably benign 0.02
R9776:Vmn2r74 UTSW 7 85,605,212 (GRCm39) missense possibly damaging 0.70
Z1176:Vmn2r74 UTSW 7 85,604,835 (GRCm39) missense probably damaging 1.00
Z31818:Vmn2r74 UTSW 7 85,604,729 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TTATCTCCTAGCAAGGGAGAGCCAG -3'
(R):5'- TGCCAAGCCCAAGGACATAAAGTG -3'

Sequencing Primer
(F):5'- ACATTCCAGCATCTCTATAATGCC -3'
(R):5'- AGTGCTTAAGAATCCTCCAGAG -3'
Posted On 2013-05-23