Mutagenetix > Incidental Mutations

Incidental Mutation 'R5223:Ptprc'

402401

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.365) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 138117862 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 87 (I87F)

Ref Sequence

ENSEMBL: ENSMUSP00000141524 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000193650] [ENSMUST00000195533]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112036

SMART Domains

Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5.8e-13	PFAM
low complexity region	31	64	N/A	INTRINSIC
Pfam:CD45	70	129	1.8e-24	PFAM
FN3	233	317	2.28e0	SMART
FN3	333	411	3.48e-1	SMART
transmembrane domain	426	447	N/A	INTRINSIC
PTPc	500	762	7.57e-127	SMART
PTPc	791	1077	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182283

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182755

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183262

Predicted Effect

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: I136F

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187586

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188596

Predicted Effect

probably benign
Transcript: ENSMUST00000193650
AA Change: I87F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141524
Gene: ENSMUSG00000026395
AA Change: I87F

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	8.4e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195533

SMART Domains

Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	7.4e-11	PFAM
low complexity region	68	115	N/A	INTRINSIC
Pfam:CD45	121	180	2.1e-22	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
bruise	UTSW	1	138064771	missense	probably damaging	1.00
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	unclassified	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0627:Ptprc	UTSW	1	138068320	missense	probably damaging	0.99
R0632:Ptprc	UTSW	1	138073610	missense	probably benign	0.01
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1862:Ptprc	UTSW	1	138112227	missense	probably benign	0.13
R2145:Ptprc	UTSW	1	138073681	missense	probably damaging	1.00
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4937:Ptprc	UTSW	1	138089500	missense	probably damaging	1.00
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5689:Ptprc	UTSW	1	138117777	missense	probably benign	0.01
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6847:Ptprc	UTSW	1	138088545	missense	probably damaging	0.99
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01
R7948:Ptprc	UTSW	1	138064576	missense	probably benign	0.45
R8029:Ptprc	UTSW	1	138078459	missense	probably damaging	1.00
Z1177:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGAGTCAGAGAAGAGCCTC -3'
(R):5'- CCAAGTTCTCATACTGACAGAACATTC -3'

Sequencing Primer
(F):5'- AGAGCCTCATTCAAGTTTGGAGC -3'
(R):5'- TCTGTGAAATAAGGATTATGGAATGG -3'

Posted On

2016-07-22