Incidental Mutation 'R5223:Kcnt1'
ID 402405
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Name potassium channel, subfamily T, member 1
Synonyms C030030G16Rik, Slack, slo2
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R5223 (G1)
Quality Score 165
Status Not validated
Chromosome 2
Chromosomal Location 25753807-25808285 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25793434 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 636 (D636G)
Ref Sequence ENSEMBL: ENSMUSP00000143482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000128502] [ENSMUST00000153001] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
AlphaFold Q6ZPR4
Predicted Effect probably benign
Transcript: ENSMUST00000037580
AA Change: D672G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740
AA Change: D672G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114172
AA Change: D658G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740
AA Change: D658G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114176
AA Change: D672G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740
AA Change: D672G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145544
Predicted Effect probably benign
Transcript: ENSMUST00000153001
SMART Domains Protein: ENSMUSP00000142532
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
PDB:4HPF|B 79 285 6e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171268
AA Change: D652G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740
AA Change: D652G

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197917
AA Change: D670G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740
AA Change: D670G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198204
AA Change: D638G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740
AA Change: D638G

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200434
AA Change: D636G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740
AA Change: D636G

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,904,278 (GRCm39) V273M possibly damaging Het
Acin1 CCGC CC 14: 54,880,398 (GRCm39) probably null Het
Acvr1b T A 15: 101,091,857 (GRCm39) C46S probably damaging Het
Ahi1 A T 10: 20,846,818 (GRCm39) H416L possibly damaging Het
Aspm T A 1: 139,406,072 (GRCm39) L1653Q probably damaging Het
Cacna1a G A 8: 85,313,824 (GRCm39) V1533M possibly damaging Het
Ccdc33 C T 9: 57,940,267 (GRCm39) E502K possibly damaging Het
Ctnnd1 C T 2: 84,447,133 (GRCm39) V371M probably damaging Het
Cyp2a12 A T 7: 26,735,888 (GRCm39) probably null Het
Dnai4 T A 4: 102,906,600 (GRCm39) S738C possibly damaging Het
Ep400 A G 5: 110,816,496 (GRCm39) V2675A probably damaging Het
Foxh1 T A 15: 76,552,929 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gpnmb C T 6: 49,033,139 (GRCm39) T539M probably benign Het
Hdac1-ps A G 17: 78,799,867 (GRCm39) E286G probably benign Het
Hspa9 A G 18: 35,085,724 (GRCm39) probably null Het
Hspg2 T C 4: 137,271,225 (GRCm39) L2454P probably damaging Het
Ift140 T A 17: 25,254,786 (GRCm39) I422N probably benign Het
Igkv6-32 T C 6: 70,051,207 (GRCm39) S50G probably benign Het
Il23r T A 6: 67,463,154 (GRCm39) Y113F probably benign Het
Klhl41 G A 2: 69,510,171 (GRCm39) W569* probably null Het
Klra4 T A 6: 130,039,110 (GRCm39) D94V probably damaging Het
Lca5 T A 9: 83,280,666 (GRCm39) H378L probably benign Het
Lhx8 T A 3: 154,027,281 (GRCm39) T254S probably damaging Het
Lrch3 C T 16: 32,734,767 (GRCm39) R86W probably damaging Het
Lrp2 T A 2: 69,354,397 (GRCm39) N477I probably damaging Het
Man2a1 T A 17: 65,019,266 (GRCm39) I710K probably benign Het
Ncor1 A T 11: 62,229,826 (GRCm39) Y881N probably damaging Het
Nhsl1 T A 10: 18,402,074 (GRCm39) V1100E probably damaging Het
Oprk1 T C 1: 5,659,519 (GRCm39) V83A probably benign Het
Or4p8 T C 2: 88,727,678 (GRCm39) T88A probably benign Het
Or5p62 A G 7: 107,771,915 (GRCm39) V12A probably benign Het
Or7g35 T C 9: 19,496,322 (GRCm39) V163A probably benign Het
Pacs1 C T 19: 5,195,169 (GRCm39) V472I probably benign Het
Pard3b T C 1: 62,383,272 (GRCm39) Y789H probably damaging Het
Pcdha2 T C 18: 37,073,844 (GRCm39) Y492H probably damaging Het
Pcnt T C 10: 76,216,106 (GRCm39) N2261D probably damaging Het
Pex5l A T 3: 33,012,945 (GRCm39) S15T probably damaging Het
Plekhg4 A G 8: 106,105,581 (GRCm39) N682S probably benign Het
Poc5 A T 13: 96,539,463 (GRCm39) M335L probably benign Het
Polr1a C T 6: 71,944,891 (GRCm39) R1316W possibly damaging Het
Pp2d1 T C 17: 53,814,873 (GRCm39) H617R probably benign Het
Pramel24 T A 4: 143,454,591 (GRCm39) S296R probably benign Het
Prpsap1 T C 11: 116,378,974 (GRCm39) K65E probably benign Het
Ptgfrn T C 3: 100,952,909 (GRCm39) E775G probably benign Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Rbbp8 C A 18: 11,854,747 (GRCm39) A324E probably benign Het
Rfx6 G T 10: 51,554,092 (GRCm39) G63* probably null Het
Rpl37a T C 1: 72,751,308 (GRCm39) M47T probably benign Het
Samm50 T G 15: 84,084,831 (GRCm39) N187K probably benign Het
Skic2 A G 17: 35,064,142 (GRCm39) probably null Het
Slamf9 T C 1: 172,303,799 (GRCm39) I48T possibly damaging Het
Slc2a12 A G 10: 22,577,931 (GRCm39) K576E probably damaging Het
Slc4a10 G A 2: 62,083,710 (GRCm39) G388S probably damaging Het
Smtn G T 11: 3,479,530 (GRCm39) N512K probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sspo A G 6: 48,455,258 (GRCm39) Y3040C probably damaging Het
Stat1 T A 1: 52,183,401 (GRCm39) V389E probably damaging Het
Sult5a1 A T 8: 123,872,161 (GRCm39) M227K probably damaging Het
Thsd4 T C 9: 59,964,325 (GRCm39) D389G probably damaging Het
Tnxb T C 17: 34,923,052 (GRCm39) V2545A possibly damaging Het
Tpo T A 12: 30,142,589 (GRCm39) I712F probably damaging Het
Trim62 T C 4: 128,803,204 (GRCm39) V418A probably damaging Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r66 T C 7: 84,657,093 (GRCm39) D104G probably benign Het
Wdr26 T C 1: 181,015,251 (GRCm39) I371V probably benign Het
Zfp273 T G 13: 67,974,298 (GRCm39) C475W probably damaging Het
Zfp738 G T 13: 67,821,182 (GRCm39) T55K probably damaging Het
Zmym2 A G 14: 57,183,971 (GRCm39) I978V probably benign Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25,782,419 (GRCm39) missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25,806,017 (GRCm39) missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25,788,766 (GRCm39) missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25,790,979 (GRCm39) missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25,778,137 (GRCm39) missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25,802,731 (GRCm39) critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25,798,164 (GRCm39) missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25,790,494 (GRCm39) critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25,791,877 (GRCm39) missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25,790,892 (GRCm39) splice site probably benign
IGL02683:Kcnt1 APN 2 25,790,937 (GRCm39) missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25,799,215 (GRCm39) critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25,784,480 (GRCm39) splice site probably benign
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25,788,276 (GRCm39) splice site probably benign
R0294:Kcnt1 UTSW 2 25,778,122 (GRCm39) missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25,797,640 (GRCm39) missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25,782,508 (GRCm39) missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25,781,255 (GRCm39) splice site probably benign
R1364:Kcnt1 UTSW 2 25,798,106 (GRCm39) missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25,790,397 (GRCm39) missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25,790,481 (GRCm39) missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25,782,372 (GRCm39) missense probably benign
R2079:Kcnt1 UTSW 2 25,790,260 (GRCm39) missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25,781,195 (GRCm39) splice site probably benign
R2295:Kcnt1 UTSW 2 25,790,933 (GRCm39) missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25,784,371 (GRCm39) missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25,790,904 (GRCm39) missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25,805,880 (GRCm39) critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25,783,226 (GRCm39) missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25,806,060 (GRCm39) missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25,767,927 (GRCm39) missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25,768,044 (GRCm39) missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25,797,638 (GRCm39) missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25,798,112 (GRCm39) missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25,799,334 (GRCm39) intron probably benign
R5243:Kcnt1 UTSW 2 25,798,086 (GRCm39) missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25,799,289 (GRCm39) missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25,791,921 (GRCm39) nonsense probably null
R5888:Kcnt1 UTSW 2 25,798,122 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,788,413 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,784,536 (GRCm39) intron probably benign
R5927:Kcnt1 UTSW 2 25,799,388 (GRCm39) intron probably benign
R6160:Kcnt1 UTSW 2 25,782,395 (GRCm39) missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25,793,397 (GRCm39) missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25,783,192 (GRCm39) missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25,782,522 (GRCm39) missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25,793,609 (GRCm39) splice site probably null
R6336:Kcnt1 UTSW 2 25,778,767 (GRCm39) splice site probably null
R6395:Kcnt1 UTSW 2 25,799,251 (GRCm39) missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25,801,063 (GRCm39) missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25,767,840 (GRCm39) intron probably benign
R7236:Kcnt1 UTSW 2 25,799,951 (GRCm39) splice site probably null
R7308:Kcnt1 UTSW 2 25,790,475 (GRCm39) missense possibly damaging 0.74
R7346:Kcnt1 UTSW 2 25,753,855 (GRCm39) unclassified probably benign
R7419:Kcnt1 UTSW 2 25,806,011 (GRCm39) missense probably benign 0.11
R7461:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7470:Kcnt1 UTSW 2 25,799,845 (GRCm39) missense probably damaging 0.96
R7566:Kcnt1 UTSW 2 25,806,048 (GRCm39) missense probably benign 0.31
R7613:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7778:Kcnt1 UTSW 2 25,791,901 (GRCm39) missense probably benign 0.10
R8031:Kcnt1 UTSW 2 25,798,054 (GRCm39) splice site probably benign
R8088:Kcnt1 UTSW 2 25,784,326 (GRCm39) missense possibly damaging 0.63
R8113:Kcnt1 UTSW 2 25,791,223 (GRCm39) missense possibly damaging 0.67
R8378:Kcnt1 UTSW 2 25,797,283 (GRCm39) missense probably benign 0.03
R8954:Kcnt1 UTSW 2 25,784,338 (GRCm39) missense probably benign
R9231:Kcnt1 UTSW 2 25,801,074 (GRCm39) missense probably benign 0.00
R9445:Kcnt1 UTSW 2 25,767,959 (GRCm39) missense probably damaging 1.00
R9733:Kcnt1 UTSW 2 25,797,351 (GRCm39) missense probably benign 0.00
Z1176:Kcnt1 UTSW 2 25,796,808 (GRCm39) missense probably benign 0.07
Z1177:Kcnt1 UTSW 2 25,799,277 (GRCm39) nonsense probably null
Z1177:Kcnt1 UTSW 2 25,791,240 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGGGGTCTACTCAACATCAC -3'
(R):5'- ACTGAGGAAGCTCCACTCAG -3'

Sequencing Primer
(F):5'- TCACCACCACTCAGGGG -3'
(R):5'- GAGGAAGCTCCACTCAGCACTC -3'
Posted On 2016-07-22