Incidental Mutation 'R5223:Slc4a10'
ID 402406
Institutional Source Beutler Lab
Gene Symbol Slc4a10
Ensembl Gene ENSMUSG00000026904
Gene Name solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms NCBE
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5223 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 62046462-62326730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 62253366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 388 (G388S)
Ref Sequence ENSEMBL: ENSMUSP00000108099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]
AlphaFold Q5DTL9
Predicted Effect probably damaging
Transcript: ENSMUST00000054484
AA Change: G358S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: G358S

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 9e-107 PFAM
Pfam:HCO3_cotransp 445 959 1e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102735
AA Change: G358S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: G358S

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 2e-106 PFAM
Pfam:HCO3_cotransp 445 959 2.4e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112480
AA Change: G388S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: G388S

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 435 9.6e-108 PFAM
Pfam:HCO3_cotransp 476 989 1.5e-245 PFAM
transmembrane domain 997 1019 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155219
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Gpnmb C T 6: 49,056,205 T539M probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Nhsl1 T A 10: 18,526,326 V1100E probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pacs1 C T 19: 5,145,141 V472I probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbbp8 C A 18: 11,721,690 A324E probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Smtn G T 11: 3,529,530 N512K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Tpo T A 12: 30,092,590 I712F probably damaging Het
Trim62 T C 4: 128,909,411 V418A probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zfp738 G T 13: 67,673,063 T55K probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Slc4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Slc4a10 APN 2 62290001 missense probably damaging 1.00
IGL00990:Slc4a10 APN 2 62286940 missense probably damaging 1.00
IGL01294:Slc4a10 APN 2 62253309 critical splice acceptor site probably null
IGL01628:Slc4a10 APN 2 62268666 missense probably damaging 1.00
IGL01773:Slc4a10 APN 2 62190757 missense probably damaging 0.97
IGL02119:Slc4a10 APN 2 62228670 missense probably damaging 1.00
IGL02125:Slc4a10 APN 2 62268171 missense probably benign 0.02
IGL02406:Slc4a10 APN 2 62190769 missense probably benign 0.37
IGL02890:Slc4a10 APN 2 62286916 missense probably damaging 1.00
IGL02959:Slc4a10 APN 2 62268143 missense probably damaging 1.00
IGL02979:Slc4a10 APN 2 62288747 missense probably null 1.00
IGL03144:Slc4a10 APN 2 62250466 missense probably benign 0.00
IGL03175:Slc4a10 APN 2 62296960 missense probably damaging 0.99
IGL03383:Slc4a10 APN 2 62267436 missense probably damaging 1.00
IGL03412:Slc4a10 APN 2 62250543 splice site probably benign
R0085:Slc4a10 UTSW 2 62244346 splice site probably benign
R0401:Slc4a10 UTSW 2 62190848 missense probably benign 0.27
R0433:Slc4a10 UTSW 2 62289983 missense probably benign 0.01
R0482:Slc4a10 UTSW 2 62297017 splice site probably benign
R0506:Slc4a10 UTSW 2 62250533 missense probably benign 0.13
R0511:Slc4a10 UTSW 2 62286862 missense probably damaging 0.97
R0590:Slc4a10 UTSW 2 62190893 splice site probably benign
R0883:Slc4a10 UTSW 2 62243398 missense probably benign 0.11
R1167:Slc4a10 UTSW 2 62228574 missense probably damaging 1.00
R1276:Slc4a10 UTSW 2 62250443 missense probably damaging 0.99
R1395:Slc4a10 UTSW 2 62313286 missense probably benign 0.00
R1455:Slc4a10 UTSW 2 62286930 missense probably damaging 1.00
R1589:Slc4a10 UTSW 2 62257462 missense probably damaging 1.00
R1677:Slc4a10 UTSW 2 62324727 missense probably benign
R1848:Slc4a10 UTSW 2 62316606 missense probably damaging 1.00
R1987:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R1988:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R2018:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2019:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2407:Slc4a10 UTSW 2 62313343 missense probably benign
R4067:Slc4a10 UTSW 2 62046645 start codon destroyed probably benign 0.00
R4184:Slc4a10 UTSW 2 62317442 intron probably benign
R4255:Slc4a10 UTSW 2 62281936 missense probably benign 0.10
R4282:Slc4a10 UTSW 2 62244343 splice site probably null
R4296:Slc4a10 UTSW 2 62234428 missense possibly damaging 0.80
R4361:Slc4a10 UTSW 2 62243385 missense probably benign 0.00
R4596:Slc4a10 UTSW 2 62296858 missense probably damaging 1.00
R4709:Slc4a10 UTSW 2 62257517 missense probably null 1.00
R4755:Slc4a10 UTSW 2 62296988 missense probably damaging 1.00
R4836:Slc4a10 UTSW 2 62268187 missense probably damaging 1.00
R4841:Slc4a10 UTSW 2 62257595 missense possibly damaging 0.68
R4998:Slc4a10 UTSW 2 62244439 missense probably benign 0.00
R5069:Slc4a10 UTSW 2 62267571 missense probably benign 0.06
R5244:Slc4a10 UTSW 2 62288725 missense probably damaging 1.00
R5386:Slc4a10 UTSW 2 62290058 missense probably damaging 1.00
R5808:Slc4a10 UTSW 2 62250472 missense probably damaging 1.00
R5999:Slc4a10 UTSW 2 62243431 missense probably benign 0.10
R6007:Slc4a10 UTSW 2 62268872 missense probably benign 0.44
R6009:Slc4a10 UTSW 2 62046690 missense probably benign 0.00
R6015:Slc4a10 UTSW 2 62228702 missense probably benign 0.05
R6103:Slc4a10 UTSW 2 62234465 missense probably damaging 1.00
R6141:Slc4a10 UTSW 2 62211445 missense probably damaging 1.00
R6193:Slc4a10 UTSW 2 62243357 splice site probably null
R6217:Slc4a10 UTSW 2 62303951 missense probably benign 0.27
R6280:Slc4a10 UTSW 2 62281966 missense probably benign 0.05
R6523:Slc4a10 UTSW 2 62286961 nonsense probably null
R6643:Slc4a10 UTSW 2 62228710 missense possibly damaging 0.96
R6660:Slc4a10 UTSW 2 62250403 missense possibly damaging 0.55
R7008:Slc4a10 UTSW 2 62286922 missense probably benign 0.00
R7083:Slc4a10 UTSW 2 62234495 missense probably benign 0.03
R7223:Slc4a10 UTSW 2 62268665 missense probably damaging 0.99
R7243:Slc4a10 UTSW 2 62303862 missense probably damaging 1.00
R7449:Slc4a10 UTSW 2 62303946 missense probably benign
R7621:Slc4a10 UTSW 2 62250479 missense probably damaging 0.98
R7692:Slc4a10 UTSW 2 62303964 missense possibly damaging 0.94
R7742:Slc4a10 UTSW 2 62296850 missense probably damaging 1.00
R7905:Slc4a10 UTSW 2 62268151 missense probably damaging 1.00
R8179:Slc4a10 UTSW 2 62243448 missense possibly damaging 0.64
R8528:Slc4a10 UTSW 2 62296796 missense possibly damaging 0.79
R8531:Slc4a10 UTSW 2 62267507 missense probably damaging 1.00
R8772:Slc4a10 UTSW 2 62303940 missense probably damaging 1.00
R9307:Slc4a10 UTSW 2 62253318 missense probably damaging 1.00
R9531:Slc4a10 UTSW 2 62268810 missense probably damaging 1.00
R9732:Slc4a10 UTSW 2 62304742 missense probably damaging 0.97
U24488:Slc4a10 UTSW 2 62046658 missense probably benign 0.05
X0019:Slc4a10 UTSW 2 62228599 missense probably damaging 1.00
Z1088:Slc4a10 UTSW 2 62228571 missense probably damaging 1.00
Z1176:Slc4a10 UTSW 2 62211379 missense probably damaging 1.00
Z1176:Slc4a10 UTSW 2 62244416 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCATTGTTTGAGGATATTGTACTG -3'
(R):5'- GAGGGCTTACAGACTTAGCC -3'

Sequencing Primer
(F):5'- GAGGATATTGTACTGAAGTCTCAATC -3'
(R):5'- CAGACTTAGCCCAGATTTTTGG -3'
Posted On 2016-07-22