Mutagenetix > Incidental Mutations

Incidental Mutation 'R5223:Slc4a10'

402406

Institutional Source

Beutler Lab

Gene Symbol

Slc4a10

Ensembl Gene

ENSMUSG00000026904

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter-like, member 10

Synonyms

NCBE

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62046462-62326730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 62253366 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 388 (G388S)

Ref Sequence

ENSEMBL: ENSMUSP00000108099 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]

AlphaFold

Q5DTL9

Predicted Effect

probably damaging
Transcript: ENSMUST00000054484
AA Change: G358S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: G358S

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	9e-107	PFAM
Pfam:HCO3_cotransp	445	959	1e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102735
AA Change: G358S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: G358S

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	2e-106	PFAM
Pfam:HCO3_cotransp	445	959	2.4e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112480
AA Change: G388S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: G388S

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	435	9.6e-108	PFAM
Pfam:HCO3_cotransp	476	989	1.5e-245	PFAM
transmembrane domain	997	1019	N/A	INTRINSIC
low complexity region	1041	1055	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155219

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Slc4a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Slc4a10	APN	2	62290001	missense	probably damaging	1.00
IGL00990:Slc4a10	APN	2	62286940	missense	probably damaging	1.00
IGL01294:Slc4a10	APN	2	62253309	critical splice acceptor site	probably null
IGL01628:Slc4a10	APN	2	62268666	missense	probably damaging	1.00
IGL01773:Slc4a10	APN	2	62190757	missense	probably damaging	0.97
IGL02119:Slc4a10	APN	2	62228670	missense	probably damaging	1.00
IGL02125:Slc4a10	APN	2	62268171	missense	probably benign	0.02
IGL02406:Slc4a10	APN	2	62190769	missense	probably benign	0.37
IGL02890:Slc4a10	APN	2	62286916	missense	probably damaging	1.00
IGL02959:Slc4a10	APN	2	62268143	missense	probably damaging	1.00
IGL02979:Slc4a10	APN	2	62288747	missense	probably null	1.00
IGL03144:Slc4a10	APN	2	62250466	missense	probably benign	0.00
IGL03175:Slc4a10	APN	2	62296960	missense	probably damaging	0.99
IGL03383:Slc4a10	APN	2	62267436	missense	probably damaging	1.00
IGL03412:Slc4a10	APN	2	62250543	splice site	probably benign
R0085:Slc4a10	UTSW	2	62244346	splice site	probably benign
R0401:Slc4a10	UTSW	2	62190848	missense	probably benign	0.27
R0433:Slc4a10	UTSW	2	62289983	missense	probably benign	0.01
R0482:Slc4a10	UTSW	2	62297017	splice site	probably benign
R0506:Slc4a10	UTSW	2	62250533	missense	probably benign	0.13
R0511:Slc4a10	UTSW	2	62286862	missense	probably damaging	0.97
R0590:Slc4a10	UTSW	2	62190893	splice site	probably benign
R0883:Slc4a10	UTSW	2	62243398	missense	probably benign	0.11
R1167:Slc4a10	UTSW	2	62228574	missense	probably damaging	1.00
R1276:Slc4a10	UTSW	2	62250443	missense	probably damaging	0.99
R1395:Slc4a10	UTSW	2	62313286	missense	probably benign	0.00
R1455:Slc4a10	UTSW	2	62286930	missense	probably damaging	1.00
R1589:Slc4a10	UTSW	2	62257462	missense	probably damaging	1.00
R1677:Slc4a10	UTSW	2	62324727	missense	probably benign
R1848:Slc4a10	UTSW	2	62316606	missense	probably damaging	1.00
R1987:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R1988:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R2018:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2019:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2407:Slc4a10	UTSW	2	62313343	missense	probably benign
R4067:Slc4a10	UTSW	2	62046645	start codon destroyed	probably benign	0.00
R4184:Slc4a10	UTSW	2	62317442	intron	probably benign
R4255:Slc4a10	UTSW	2	62281936	missense	probably benign	0.10
R4282:Slc4a10	UTSW	2	62244343	splice site	probably null
R4296:Slc4a10	UTSW	2	62234428	missense	possibly damaging	0.80
R4361:Slc4a10	UTSW	2	62243385	missense	probably benign	0.00
R4596:Slc4a10	UTSW	2	62296858	missense	probably damaging	1.00
R4709:Slc4a10	UTSW	2	62257517	missense	probably null	1.00
R4755:Slc4a10	UTSW	2	62296988	missense	probably damaging	1.00
R4836:Slc4a10	UTSW	2	62268187	missense	probably damaging	1.00
R4841:Slc4a10	UTSW	2	62257595	missense	possibly damaging	0.68
R4998:Slc4a10	UTSW	2	62244439	missense	probably benign	0.00
R5069:Slc4a10	UTSW	2	62267571	missense	probably benign	0.06
R5244:Slc4a10	UTSW	2	62288725	missense	probably damaging	1.00
R5386:Slc4a10	UTSW	2	62290058	missense	probably damaging	1.00
R5808:Slc4a10	UTSW	2	62250472	missense	probably damaging	1.00
R5999:Slc4a10	UTSW	2	62243431	missense	probably benign	0.10
R6007:Slc4a10	UTSW	2	62268872	missense	probably benign	0.44
R6009:Slc4a10	UTSW	2	62046690	missense	probably benign	0.00
R6015:Slc4a10	UTSW	2	62228702	missense	probably benign	0.05
R6103:Slc4a10	UTSW	2	62234465	missense	probably damaging	1.00
R6141:Slc4a10	UTSW	2	62211445	missense	probably damaging	1.00
R6193:Slc4a10	UTSW	2	62243357	splice site	probably null
R6217:Slc4a10	UTSW	2	62303951	missense	probably benign	0.27
R6280:Slc4a10	UTSW	2	62281966	missense	probably benign	0.05
R6523:Slc4a10	UTSW	2	62286961	nonsense	probably null
R6643:Slc4a10	UTSW	2	62228710	missense	possibly damaging	0.96
R6660:Slc4a10	UTSW	2	62250403	missense	possibly damaging	0.55
R7008:Slc4a10	UTSW	2	62286922	missense	probably benign	0.00
R7083:Slc4a10	UTSW	2	62234495	missense	probably benign	0.03
R7223:Slc4a10	UTSW	2	62268665	missense	probably damaging	0.99
R7243:Slc4a10	UTSW	2	62303862	missense	probably damaging	1.00
R7449:Slc4a10	UTSW	2	62303946	missense	probably benign
R7621:Slc4a10	UTSW	2	62250479	missense	probably damaging	0.98
R7692:Slc4a10	UTSW	2	62303964	missense	possibly damaging	0.94
R7742:Slc4a10	UTSW	2	62296850	missense	probably damaging	1.00
R7905:Slc4a10	UTSW	2	62268151	missense	probably damaging	1.00
R8179:Slc4a10	UTSW	2	62243448	missense	possibly damaging	0.64
R8528:Slc4a10	UTSW	2	62296796	missense	possibly damaging	0.79
R8531:Slc4a10	UTSW	2	62267507	missense	probably damaging	1.00
R8772:Slc4a10	UTSW	2	62303940	missense	probably damaging	1.00
R9307:Slc4a10	UTSW	2	62253318	missense	probably damaging	1.00
U24488:Slc4a10	UTSW	2	62046658	missense	probably benign	0.05
X0019:Slc4a10	UTSW	2	62228599	missense	probably damaging	1.00
Z1088:Slc4a10	UTSW	2	62228571	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62211379	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62244416	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCATTGTTTGAGGATATTGTACTG -3'
(R):5'- GAGGGCTTACAGACTTAGCC -3'

Sequencing Primer
(F):5'- GAGGATATTGTACTGAAGTCTCAATC -3'
(R):5'- CAGACTTAGCCCAGATTTTTGG -3'

Posted On

2016-07-22