Mutagenetix > Incidental Mutations

Incidental Mutation 'R5223:Klhl41'

402408

Institutional Source

Beutler Lab

Gene Symbol

Klhl41

Ensembl Gene

ENSMUSG00000075307

Gene Name

kelch-like 41

Synonyms

LOC228003, Kbtbd10

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69670120-69684230 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 69679827 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 569 (W569*)

Ref Sequence

ENSEMBL: ENSMUSP00000097627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100050]

Predicted Effect

probably null
Transcript: ENSMUST00000100050
AA Change: W569*

SMART Domains

Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307
AA Change: W569*

Domain	Start	End	E-Value	Type
BTB	33	130	8.34e-27	SMART
BACK	135	237	9.67e-36	SMART
Kelch	346	398	6.71e-1	SMART
Kelch	399	447	1.56e-5	SMART
Kelch	448	495	2.43e-7	SMART
Kelch	496	542	5.81e-5	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Klhl41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01316:Klhl41	APN	2	69674724	missense	probably benign	0.00
IGL01622:Klhl41	APN	2	69678238	missense	probably benign	0.05
IGL01623:Klhl41	APN	2	69678238	missense	probably benign	0.05
IGL03237:Klhl41	APN	2	69670558	missense	possibly damaging	0.94
R0220:Klhl41	UTSW	2	69670485	missense	probably benign	0.25
R0277:Klhl41	UTSW	2	69671296	missense	probably damaging	1.00
R0456:Klhl41	UTSW	2	69670549	missense	probably damaging	0.99
R0485:Klhl41	UTSW	2	69671256	missense	probably damaging	0.97
R0536:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0537:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0552:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0553:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0834:Klhl41	UTSW	2	69678147	missense	possibly damaging	0.76
R0879:Klhl41	UTSW	2	69683483	unclassified	probably benign
R1531:Klhl41	UTSW	2	69670740	missense	probably benign	0.03
R1678:Klhl41	UTSW	2	69670939	missense	probably benign	0.01
R1792:Klhl41	UTSW	2	69670802	missense	probably benign	0.01
R1900:Klhl41	UTSW	2	69674619	splice site	probably benign
R2012:Klhl41	UTSW	2	69683496	missense	possibly damaging	0.61
R4041:Klhl41	UTSW	2	69670710	missense	probably benign	0.00
R5500:Klhl41	UTSW	2	69683529	missense	probably damaging	1.00
R5643:Klhl41	UTSW	2	69670471	missense	probably damaging	1.00
R5644:Klhl41	UTSW	2	69670471	missense	probably damaging	1.00
R5656:Klhl41	UTSW	2	69683532	missense	possibly damaging	0.89
R6264:Klhl41	UTSW	2	69679832	critical splice donor site	probably null
R6678:Klhl41	UTSW	2	69670844	missense	probably benign	0.04
R6731:Klhl41	UTSW	2	69674700	missense	probably damaging	1.00
R7586:Klhl41	UTSW	2	69674724	missense	probably benign	0.33
R7664:Klhl41	UTSW	2	69670717	missense	probably damaging	1.00
R8158:Klhl41	UTSW	2	69671161	missense	probably damaging	1.00
R8341:Klhl41	UTSW	2	69670524	missense	probably benign	0.07
X0021:Klhl41	UTSW	2	69679706	missense	probably damaging	1.00
Z1088:Klhl41	UTSW	2	69674730	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- CTGGATAGTAAGGGTAAATGCTCCAG -3'
(R):5'- TGGTCAGAAAGTTGCATATTCG -3'

Sequencing Primer
(F):5'- GACAGATCTCTGAGTTCCAGGAC -3'
(R):5'- CAGAAAGTTGCATATTCGAAAGTTC -3'

Posted On

2016-07-22