Incidental Mutation 'R5223:Ctnnd1'
ID 402409
Institutional Source Beutler Lab
Gene Symbol Ctnnd1
Ensembl Gene ENSMUSG00000034101
Gene Name catenin delta 1
Synonyms Ctnnd, Catns, p120-catenin, catenin (cadherin associated protein), delta 1, P120
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5223 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 84430415-84481109 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84447133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 371 (V371M)
Ref Sequence ENSEMBL: ENSMUSP00000141166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036811] [ENSMUST00000066177] [ENSMUST00000067232] [ENSMUST00000099941] [ENSMUST00000111670] [ENSMUST00000111675] [ENSMUST00000111691] [ENSMUST00000111676] [ENSMUST00000111677] [ENSMUST00000111678] [ENSMUST00000111684] [ENSMUST00000111685] [ENSMUST00000111686] [ENSMUST00000111687] [ENSMUST00000111688] [ENSMUST00000111689] [ENSMUST00000111690] [ENSMUST00000111692] [ENSMUST00000111693] [ENSMUST00000111694] [ENSMUST00000111695] [ENSMUST00000111696] [ENSMUST00000111697] [ENSMUST00000111698] [ENSMUST00000189772]
AlphaFold P30999
Predicted Effect probably damaging
Transcript: ENSMUST00000036811
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042543
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066177
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065252
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 1.2e-8 SMART
ARM 440 481 1.3e-10 SMART
ARM 482 539 3e-1 SMART
ARM 541 588 1.8e-2 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 5.7e-7 SMART
ARM 783 825 2.1e-1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000067232
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064518
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099941
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097524
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 8e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111670
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107299
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 9e-20 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111675
AA Change: V48M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107304
Gene: ENSMUSG00000034101
AA Change: V48M

DomainStartEndE-ValueType
ARM 74 114 2.53e-6 SMART
ARM 117 158 2.8e-8 SMART
ARM 159 216 6.3e1 SMART
ARM 218 265 3.74e0 SMART
Blast:ARM 322 364 8e-20 BLAST
ARM 370 410 1.23e-4 SMART
ARM 460 502 4.41e1 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111691
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107320
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111676
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107305
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 1e-19 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 836 848 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111677
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107306
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 815 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111678
AA Change: V270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107307
Gene: ENSMUSG00000034101
AA Change: V270M

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 9e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111684
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107313
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 889 901 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111685
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107314
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111686
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107315
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111687
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107316
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 8e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111688
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107317
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111689
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107318
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111690
AA Change: V317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107319
Gene: ENSMUSG00000034101
AA Change: V317M

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111692
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107321
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111693
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107322
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111694
AA Change: V371M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107323
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111695
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107324
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111696
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107325
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111697
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107326
Gene: ENSMUSG00000034101
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111698
AA Change: V307M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107327
Gene: ENSMUSG00000034101
AA Change: V307M

DomainStartEndE-ValueType
low complexity region 62 89 N/A INTRINSIC
ARM 333 373 2.53e-6 SMART
ARM 376 417 2.8e-8 SMART
ARM 418 475 6.3e1 SMART
ARM 477 524 3.74e0 SMART
Blast:ARM 581 623 8e-20 BLAST
ARM 629 669 1.23e-4 SMART
ARM 719 761 4.41e1 SMART
low complexity region 787 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145312
Predicted Effect probably damaging
Transcript: ENSMUST00000189772
AA Change: V371M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645
AA Change: V371M

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131926
Meta Mutation Damage Score 0.7603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Armadillo protein family, which function in adhesion between cells and signal transduction. Multiple translation initiation codons and alternative splicing result in many different isoforms being translated. Not all of the full-length natures of the described transcript variants have been determined. Read-through transcription also exists between this gene and the neighboring upstream thioredoxin-related transmembrane protein 2 (TMX2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene die shortly after birth and have morphological abnormalities of the salivary glands and lacrimal gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,904,278 (GRCm39) V273M possibly damaging Het
Acin1 CCGC CC 14: 54,880,398 (GRCm39) probably null Het
Acvr1b T A 15: 101,091,857 (GRCm39) C46S probably damaging Het
Ahi1 A T 10: 20,846,818 (GRCm39) H416L possibly damaging Het
Aspm T A 1: 139,406,072 (GRCm39) L1653Q probably damaging Het
Cacna1a G A 8: 85,313,824 (GRCm39) V1533M possibly damaging Het
Ccdc33 C T 9: 57,940,267 (GRCm39) E502K possibly damaging Het
Cyp2a12 A T 7: 26,735,888 (GRCm39) probably null Het
Dnai4 T A 4: 102,906,600 (GRCm39) S738C possibly damaging Het
Ep400 A G 5: 110,816,496 (GRCm39) V2675A probably damaging Het
Foxh1 T A 15: 76,552,929 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gpnmb C T 6: 49,033,139 (GRCm39) T539M probably benign Het
Hdac1-ps A G 17: 78,799,867 (GRCm39) E286G probably benign Het
Hspa9 A G 18: 35,085,724 (GRCm39) probably null Het
Hspg2 T C 4: 137,271,225 (GRCm39) L2454P probably damaging Het
Ift140 T A 17: 25,254,786 (GRCm39) I422N probably benign Het
Igkv6-32 T C 6: 70,051,207 (GRCm39) S50G probably benign Het
Il23r T A 6: 67,463,154 (GRCm39) Y113F probably benign Het
Kcnt1 A G 2: 25,793,434 (GRCm39) D636G probably benign Het
Klhl41 G A 2: 69,510,171 (GRCm39) W569* probably null Het
Klra4 T A 6: 130,039,110 (GRCm39) D94V probably damaging Het
Lca5 T A 9: 83,280,666 (GRCm39) H378L probably benign Het
Lhx8 T A 3: 154,027,281 (GRCm39) T254S probably damaging Het
Lrch3 C T 16: 32,734,767 (GRCm39) R86W probably damaging Het
Lrp2 T A 2: 69,354,397 (GRCm39) N477I probably damaging Het
Man2a1 T A 17: 65,019,266 (GRCm39) I710K probably benign Het
Ncor1 A T 11: 62,229,826 (GRCm39) Y881N probably damaging Het
Nhsl1 T A 10: 18,402,074 (GRCm39) V1100E probably damaging Het
Oprk1 T C 1: 5,659,519 (GRCm39) V83A probably benign Het
Or4p8 T C 2: 88,727,678 (GRCm39) T88A probably benign Het
Or5p62 A G 7: 107,771,915 (GRCm39) V12A probably benign Het
Or7g35 T C 9: 19,496,322 (GRCm39) V163A probably benign Het
Pacs1 C T 19: 5,195,169 (GRCm39) V472I probably benign Het
Pard3b T C 1: 62,383,272 (GRCm39) Y789H probably damaging Het
Pcdha2 T C 18: 37,073,844 (GRCm39) Y492H probably damaging Het
Pcnt T C 10: 76,216,106 (GRCm39) N2261D probably damaging Het
Pex5l A T 3: 33,012,945 (GRCm39) S15T probably damaging Het
Plekhg4 A G 8: 106,105,581 (GRCm39) N682S probably benign Het
Poc5 A T 13: 96,539,463 (GRCm39) M335L probably benign Het
Polr1a C T 6: 71,944,891 (GRCm39) R1316W possibly damaging Het
Pp2d1 T C 17: 53,814,873 (GRCm39) H617R probably benign Het
Pramel24 T A 4: 143,454,591 (GRCm39) S296R probably benign Het
Prpsap1 T C 11: 116,378,974 (GRCm39) K65E probably benign Het
Ptgfrn T C 3: 100,952,909 (GRCm39) E775G probably benign Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Rbbp8 C A 18: 11,854,747 (GRCm39) A324E probably benign Het
Rfx6 G T 10: 51,554,092 (GRCm39) G63* probably null Het
Rpl37a T C 1: 72,751,308 (GRCm39) M47T probably benign Het
Samm50 T G 15: 84,084,831 (GRCm39) N187K probably benign Het
Skic2 A G 17: 35,064,142 (GRCm39) probably null Het
Slamf9 T C 1: 172,303,799 (GRCm39) I48T possibly damaging Het
Slc2a12 A G 10: 22,577,931 (GRCm39) K576E probably damaging Het
Slc4a10 G A 2: 62,083,710 (GRCm39) G388S probably damaging Het
Smtn G T 11: 3,479,530 (GRCm39) N512K probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sspo A G 6: 48,455,258 (GRCm39) Y3040C probably damaging Het
Stat1 T A 1: 52,183,401 (GRCm39) V389E probably damaging Het
Sult5a1 A T 8: 123,872,161 (GRCm39) M227K probably damaging Het
Thsd4 T C 9: 59,964,325 (GRCm39) D389G probably damaging Het
Tnxb T C 17: 34,923,052 (GRCm39) V2545A possibly damaging Het
Tpo T A 12: 30,142,589 (GRCm39) I712F probably damaging Het
Trim62 T C 4: 128,803,204 (GRCm39) V418A probably damaging Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r66 T C 7: 84,657,093 (GRCm39) D104G probably benign Het
Wdr26 T C 1: 181,015,251 (GRCm39) I371V probably benign Het
Zfp273 T G 13: 67,974,298 (GRCm39) C475W probably damaging Het
Zfp738 G T 13: 67,821,182 (GRCm39) T55K probably damaging Het
Zmym2 A G 14: 57,183,971 (GRCm39) I978V probably benign Het
Other mutations in Ctnnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ctnnd1 APN 2 84,439,969 (GRCm39) missense probably damaging 0.99
IGL00846:Ctnnd1 APN 2 84,452,354 (GRCm39) critical splice donor site probably null
IGL00861:Ctnnd1 APN 2 84,434,096 (GRCm39) missense probably damaging 0.97
IGL01394:Ctnnd1 APN 2 84,435,600 (GRCm39) splice site probably benign
IGL02035:Ctnnd1 APN 2 84,450,425 (GRCm39) missense probably damaging 1.00
IGL02536:Ctnnd1 APN 2 84,435,540 (GRCm39) missense probably benign 0.00
IGL02859:Ctnnd1 APN 2 84,450,253 (GRCm39) splice site probably benign
IGL03270:Ctnnd1 APN 2 84,440,071 (GRCm39) splice site probably null
IGL02802:Ctnnd1 UTSW 2 84,454,806 (GRCm39) start codon destroyed probably null 0.99
R0449:Ctnnd1 UTSW 2 84,433,606 (GRCm39) missense possibly damaging 0.53
R0487:Ctnnd1 UTSW 2 84,439,411 (GRCm39) missense probably damaging 1.00
R0652:Ctnnd1 UTSW 2 84,433,240 (GRCm39) missense probably benign 0.40
R1503:Ctnnd1 UTSW 2 84,435,523 (GRCm39) splice site probably null
R1701:Ctnnd1 UTSW 2 84,439,335 (GRCm39) missense probably damaging 1.00
R1796:Ctnnd1 UTSW 2 84,445,553 (GRCm39) missense probably damaging 1.00
R2001:Ctnnd1 UTSW 2 84,450,704 (GRCm39) missense probably benign 0.00
R2002:Ctnnd1 UTSW 2 84,450,704 (GRCm39) missense probably benign 0.00
R2185:Ctnnd1 UTSW 2 84,442,892 (GRCm39) missense probably damaging 1.00
R2192:Ctnnd1 UTSW 2 84,439,907 (GRCm39) missense probably damaging 1.00
R2203:Ctnnd1 UTSW 2 84,447,024 (GRCm39) missense probably damaging 1.00
R2389:Ctnnd1 UTSW 2 84,454,615 (GRCm39) missense probably null 0.94
R2872:Ctnnd1 UTSW 2 84,451,232 (GRCm39) missense possibly damaging 0.88
R2872:Ctnnd1 UTSW 2 84,451,232 (GRCm39) missense possibly damaging 0.88
R3846:Ctnnd1 UTSW 2 84,447,271 (GRCm39) missense probably benign 0.04
R4019:Ctnnd1 UTSW 2 84,450,302 (GRCm39) missense probably damaging 1.00
R4194:Ctnnd1 UTSW 2 84,434,045 (GRCm39) missense possibly damaging 0.93
R4796:Ctnnd1 UTSW 2 84,450,270 (GRCm39) missense probably damaging 1.00
R4847:Ctnnd1 UTSW 2 84,452,396 (GRCm39) nonsense probably null
R4964:Ctnnd1 UTSW 2 84,452,417 (GRCm39) missense possibly damaging 0.85
R4966:Ctnnd1 UTSW 2 84,452,417 (GRCm39) missense possibly damaging 0.85
R5336:Ctnnd1 UTSW 2 84,447,133 (GRCm39) missense probably damaging 1.00
R5428:Ctnnd1 UTSW 2 84,447,133 (GRCm39) missense probably damaging 1.00
R5429:Ctnnd1 UTSW 2 84,447,133 (GRCm39) missense probably damaging 1.00
R5974:Ctnnd1 UTSW 2 84,451,259 (GRCm39) nonsense probably null
R6018:Ctnnd1 UTSW 2 84,480,812 (GRCm39) intron probably benign
R6285:Ctnnd1 UTSW 2 84,444,231 (GRCm39) critical splice donor site probably null
R6562:Ctnnd1 UTSW 2 84,454,652 (GRCm39) missense probably benign
R6661:Ctnnd1 UTSW 2 84,439,986 (GRCm39) missense probably damaging 1.00
R6694:Ctnnd1 UTSW 2 84,454,849 (GRCm39) start gained probably benign
R6769:Ctnnd1 UTSW 2 84,450,454 (GRCm39) missense probably damaging 1.00
R6769:Ctnnd1 UTSW 2 84,450,269 (GRCm39) missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84,450,454 (GRCm39) missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84,450,269 (GRCm39) missense probably damaging 1.00
R6916:Ctnnd1 UTSW 2 84,439,990 (GRCm39) missense probably benign 0.02
R7025:Ctnnd1 UTSW 2 84,440,950 (GRCm39) missense possibly damaging 0.82
R7208:Ctnnd1 UTSW 2 84,452,390 (GRCm39) missense possibly damaging 0.48
R7466:Ctnnd1 UTSW 2 84,441,129 (GRCm39) missense probably benign 0.30
R7583:Ctnnd1 UTSW 2 84,442,405 (GRCm39) missense probably damaging 0.99
R8087:Ctnnd1 UTSW 2 84,441,220 (GRCm39) missense possibly damaging 0.65
R8458:Ctnnd1 UTSW 2 84,444,287 (GRCm39) missense probably damaging 1.00
R8723:Ctnnd1 UTSW 2 84,450,384 (GRCm39) missense probably benign 0.03
R9087:Ctnnd1 UTSW 2 84,439,922 (GRCm39) missense probably damaging 1.00
R9318:Ctnnd1 UTSW 2 84,438,682 (GRCm39) missense probably benign 0.01
R9651:Ctnnd1 UTSW 2 84,439,899 (GRCm39) missense possibly damaging 0.89
R9736:Ctnnd1 UTSW 2 84,442,430 (GRCm39) missense probably benign 0.19
X0062:Ctnnd1 UTSW 2 84,445,558 (GRCm39) missense probably damaging 1.00
Z1177:Ctnnd1 UTSW 2 84,445,516 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCTTGAGAGCTCCACAGGC -3'
(R):5'- TGTCTATGAAGCCAGATTTAACTGC -3'

Sequencing Primer
(F):5'- AGGCTCCGAGGTGCACTTC -3'
(R):5'- GAAGCCAGATTTAACTGCTTGGTTC -3'
Posted On 2016-07-22