Incidental Mutation 'R5223:Trim62'
ID402417
Institutional Source Beutler Lab
Gene Symbol Trim62
Ensembl Gene ENSMUSG00000041000
Gene Nametripartite motif-containing 62
Synonyms
MMRRC Submission 042796-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5223 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location128883580-128911328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128909411 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 418 (V418A)
Ref Sequence ENSEMBL: ENSMUSP00000039121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035667]
Predicted Effect probably damaging
Transcript: ENSMUST00000035667
AA Change: V418A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039121
Gene: ENSMUSG00000041000
AA Change: V418A

DomainStartEndE-ValueType
RING 11 53 1.85e-8 SMART
Pfam:zf-B_box 88 128 4e-8 PFAM
low complexity region 133 147 N/A INTRINSIC
PRY 294 347 2.07e-20 SMART
Pfam:SPRY 350 467 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous or homozygous for a targeted allele exhibit increased tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Gpnmb C T 6: 49,056,205 T539M probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Nhsl1 T A 10: 18,526,326 V1100E probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pacs1 C T 19: 5,145,141 V472I probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbbp8 C A 18: 11,721,690 A324E probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Slc4a10 G A 2: 62,253,366 G388S probably damaging Het
Smtn G T 11: 3,529,530 N512K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Tpo T A 12: 30,092,590 I712F probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zfp738 G T 13: 67,673,063 T55K probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Trim62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Trim62 APN 4 128884459 missense probably benign 0.05
R0201:Trim62 UTSW 4 128902550 missense probably benign
R0744:Trim62 UTSW 4 128884215 missense probably damaging 1.00
R1619:Trim62 UTSW 4 128909488 missense probably damaging 0.98
R1834:Trim62 UTSW 4 128909225 missense possibly damaging 0.69
R5494:Trim62 UTSW 4 128885206 missense possibly damaging 0.96
R6909:Trim62 UTSW 4 128884228 missense probably damaging 1.00
R6959:Trim62 UTSW 4 128909162 missense probably damaging 1.00
R7507:Trim62 UTSW 4 128896871 missense probably benign 0.01
R7544:Trim62 UTSW 4 128902553 missense probably benign 0.04
R7612:Trim62 UTSW 4 128896884 missense probably benign 0.03
R7624:Trim62 UTSW 4 128883678 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGCGGTGTCCACTACTG -3'
(R):5'- TCTGCCCAGATTAGATGCGG -3'

Sequencing Primer
(F):5'- TCCACTACTGGGAGGTGG -3'
(R):5'- CCAGATTAGATGCGGACGGTG -3'
Posted On2016-07-22