Incidental Mutation 'R5223:Gpnmb'
ID 402422
Institutional Source Beutler Lab
Gene Symbol Gpnmb
Ensembl Gene ENSMUSG00000029816
Gene Name glycoprotein (transmembrane) nmb
Synonyms Osteoactivin, Dchil
MMRRC Submission 042796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5223 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 49036546-49070929 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 49056205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 539 (T539M)
Ref Sequence ENSEMBL: ENSMUSP00000031840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031840] [ENSMUST00000204260]
AlphaFold Q99P91
Predicted Effect probably benign
Transcript: ENSMUST00000031840
AA Change: T539M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031840
Gene: ENSMUSG00000029816
AA Change: T539M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 500 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204260
SMART Domains Protein: ENSMUSP00000145376
Gene: ENSMUSG00000029816

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 503 525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit dispersed pigmentation of the iris, deterioration of the posterior iris epithelium and slit-like transillumination defects. The mutation contributes to glaucoma, especially in combination with the brown coat color mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Nhsl1 T A 10: 18,526,326 V1100E probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pacs1 C T 19: 5,145,141 V472I probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbbp8 C A 18: 11,721,690 A324E probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Slc4a10 G A 2: 62,253,366 G388S probably damaging Het
Smtn G T 11: 3,529,530 N512K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Tpo T A 12: 30,092,590 I712F probably damaging Het
Trim62 T C 4: 128,909,411 V418A probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zfp738 G T 13: 67,673,063 T55K probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Gpnmb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Gpnmb APN 6 49055659 missense probably benign 0.01
IGL01291:Gpnmb APN 6 49055681 missense probably benign 0.12
IGL01307:Gpnmb APN 6 49045365 missense probably benign 0.03
IGL01398:Gpnmb APN 6 49050431 missense probably benign 0.02
IGL01531:Gpnmb APN 6 49047458 splice site probably benign
IGL01936:Gpnmb APN 6 49047450 missense probably null 1.00
ANU05:Gpnmb UTSW 6 49055681 missense probably benign 0.12
R0242:Gpnmb UTSW 6 49047342 missense probably damaging 0.99
R0242:Gpnmb UTSW 6 49047342 missense probably damaging 0.99
R0413:Gpnmb UTSW 6 49042803 missense probably benign
R0690:Gpnmb UTSW 6 49048015 missense probably benign 0.24
R0884:Gpnmb UTSW 6 49047913 missense possibly damaging 0.65
R1659:Gpnmb UTSW 6 49047852 missense probably damaging 1.00
R3703:Gpnmb UTSW 6 49051865 missense possibly damaging 0.95
R3705:Gpnmb UTSW 6 49051865 missense possibly damaging 0.95
R4629:Gpnmb UTSW 6 49051060 missense possibly damaging 0.82
R4782:Gpnmb UTSW 6 49045483 splice site probably null
R4799:Gpnmb UTSW 6 49045483 splice site probably null
R4916:Gpnmb UTSW 6 49051970 missense probably damaging 1.00
R5390:Gpnmb UTSW 6 49047841 missense probably damaging 1.00
R5512:Gpnmb UTSW 6 49045464 missense possibly damaging 0.62
R5833:Gpnmb UTSW 6 49044018 missense probably damaging 1.00
R6103:Gpnmb UTSW 6 49042886 missense possibly damaging 0.86
R7211:Gpnmb UTSW 6 49052015 missense possibly damaging 0.82
R7900:Gpnmb UTSW 6 49050466 missense possibly damaging 0.83
R8859:Gpnmb UTSW 6 49052030 splice site probably benign
R9383:Gpnmb UTSW 6 49051984 missense probably damaging 1.00
R9393:Gpnmb UTSW 6 49048062 missense possibly damaging 0.89
Z1176:Gpnmb UTSW 6 49051832 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTCAAAGTGAGTGCTTCTTGCTTG -3'
(R):5'- TGCACAGCTCACATACATGC -3'

Sequencing Primer
(F):5'- AATAGCTATACTCTCCTGTGATGCTG -3'
(R):5'- CACAGAAGAGTGGGTTCCTGGTC -3'
Posted On 2016-07-22