Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Il23r'

402423

Institutional Source

Beutler Lab

Gene Symbol

Il23r

Ensembl Gene

ENSMUSG00000049093

Gene Name

interleukin 23 receptor

Synonyms

MMRRC Submission

042796-MU

Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67422932-67491855 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67486170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 113 (Y113F)

Ref Sequence

ENSEMBL: ENSMUSP00000113342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118364]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000118364
AA Change: Y113F

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093
AA Change: Y113F

Domain	Start	End	E-Value	Type
FN3	140	220	1e-1	SMART
Blast:FN3	235	317	2e-38	BLAST
transmembrane domain	388	410	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Il23r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Il23r	APN	6	67423628	missense	probably damaging	0.96
IGL00886:Il23r	APN	6	67473890	missense	possibly damaging	0.94
IGL00916:Il23r	APN	6	67473931	missense	probably damaging	1.00
IGL01102:Il23r	APN	6	67423925	missense	probably damaging	0.98
IGL01466:Il23r	APN	6	67426642	missense	probably benign	0.30
IGL01627:Il23r	APN	6	67423428	missense	probably benign	0.17
IGL02160:Il23r	APN	6	67423578	missense	probably benign	0.09
IGL02394:Il23r	APN	6	67466272	splice site	probably benign
IGL02418:Il23r	APN	6	67490672	missense	possibly damaging	0.46
IGL02818:Il23r	APN	6	67486094	critical splice donor site	probably null
IGL03230:Il23r	APN	6	67423964	missense	probably benign	0.31
R0029:Il23r	UTSW	6	67478945	critical splice donor site	probably null
R0029:Il23r	UTSW	6	67478945	critical splice donor site	probably null
R0035:Il23r	UTSW	6	67473788	splice site	probably benign
R0035:Il23r	UTSW	6	67473788	splice site	probably benign
R0085:Il23r	UTSW	6	67486222	missense	probably damaging	1.00
R0477:Il23r	UTSW	6	67452377	missense	probably benign	0.00
R0534:Il23r	UTSW	6	67426588	missense	probably benign	0.00
R0547:Il23r	UTSW	6	67423701	missense	probably benign	0.05
R0547:Il23r	UTSW	6	67486251	missense	possibly damaging	0.57
R0666:Il23r	UTSW	6	67434680	missense	probably benign	0.08
R0702:Il23r	UTSW	6	67466285	missense	probably damaging	0.97
R0715:Il23r	UTSW	6	67486333	missense	possibly damaging	0.63
R1077:Il23r	UTSW	6	67473810	missense	probably benign	0.40
R1202:Il23r	UTSW	6	67478953	missense	possibly damaging	0.95
R1328:Il23r	UTSW	6	67491818	start gained	probably benign
R1378:Il23r	UTSW	6	67452410	missense	possibly damaging	0.68
R1420:Il23r	UTSW	6	67486197	missense	probably damaging	1.00
R1475:Il23r	UTSW	6	67452296	critical splice donor site	probably null
R1628:Il23r	UTSW	6	67423609	missense	probably damaging	1.00
R1745:Il23r	UTSW	6	67466291	missense	probably damaging	0.98
R1887:Il23r	UTSW	6	67473801	missense	possibly damaging	0.88
R1901:Il23r	UTSW	6	67423734	missense	probably benign	0.44
R1902:Il23r	UTSW	6	67423734	missense	probably benign	0.44
R1928:Il23r	UTSW	6	67423735	missense	possibly damaging	0.79
R1984:Il23r	UTSW	6	67490668	splice site	probably null
R1985:Il23r	UTSW	6	67490668	splice site	probably null
R2264:Il23r	UTSW	6	67426667	critical splice acceptor site	probably null
R2290:Il23r	UTSW	6	67423861	missense	probably benign	0.17
R2363:Il23r	UTSW	6	67452417	missense	probably benign	0.08
R3430:Il23r	UTSW	6	67452474	missense	probably benign	0.08
R3964:Il23r	UTSW	6	67466297	missense	probably benign	0.13
R4073:Il23r	UTSW	6	67486122	missense	probably damaging	1.00
R4164:Il23r	UTSW	6	67423663	missense	probably benign	0.00
R4643:Il23r	UTSW	6	67423993	missense	probably benign	0.08
R4700:Il23r	UTSW	6	67473850	missense	probably damaging	1.00
R4703:Il23r	UTSW	6	67490702	missense	probably damaging	1.00
R4720:Il23r	UTSW	6	67423661	missense	probably damaging	1.00
R4828:Il23r	UTSW	6	67431651	missense	probably benign	0.31
R4911:Il23r	UTSW	6	67423561	missense	probably benign	0.17
R5119:Il23r	UTSW	6	67466316	missense	probably damaging	1.00
R5152:Il23r	UTSW	6	67423741	missense	probably damaging	0.98
R5271:Il23r	UTSW	6	67423696	missense	probably benign	0.16
R5330:Il23r	UTSW	6	67423495	missense	probably damaging	1.00
R5331:Il23r	UTSW	6	67423495	missense	probably damaging	1.00
R5384:Il23r	UTSW	6	67486291	missense	probably benign	0.10
R5874:Il23r	UTSW	6	67431645	missense	possibly damaging	0.92
R6037:Il23r	UTSW	6	67478954	missense	probably damaging	0.99
R6037:Il23r	UTSW	6	67478954	missense	probably damaging	0.99
R6377:Il23r	UTSW	6	67423652	missense	probably damaging	0.99
R6925:Il23r	UTSW	6	67423493	missense	probably damaging	1.00
R6975:Il23r	UTSW	6	67423368	missense	probably damaging	1.00
R7529:Il23r	UTSW	6	67490736	missense	possibly damaging	0.84
R7757:Il23r	UTSW	6	67423981	missense	probably benign	0.02
R7832:Il23r	UTSW	6	67423862	missense	probably benign	0.08
R7946:Il23r	UTSW	6	67434664	missense	possibly damaging	0.69
R8078:Il23r	UTSW	6	67423593	missense	probably damaging	0.99
R8391:Il23r	UTSW	6	67452390	missense	probably benign	0.27
R8784:Il23r	UTSW	6	67466417	missense	probably damaging	1.00
R9280:Il23r	UTSW	6	67452426	missense	probably damaging	1.00
R9352:Il23r	UTSW	6	67426608	missense	probably damaging	0.98
R9362:Il23r	UTSW	6	67423400	missense	probably damaging	1.00
R9768:Il23r	UTSW	6	67431619	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCCAGTTTCAAACCGATC -3'
(R):5'- CAAGTATAAACTGCTCTGGTGACATG -3'

Sequencing Primer
(F):5'- CCAGTTTCAAACCGATCTGATAC -3'
(R):5'- TGACATGTGGGTTGAGCC -3'

Posted On

2016-07-22