Incidental Mutation 'R5223:Plekhg4'
ID 402432
Institutional Source Beutler Lab
Gene Symbol Plekhg4
Ensembl Gene ENSMUSG00000014782
Gene Name pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms 4931414L13Rik
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R5223 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 106099906-106109494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106105581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 682 (N682S)
Ref Sequence ENSEMBL: ENSMUSP00000150574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000160650] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
AlphaFold A0A1L1SU27
Predicted Effect probably benign
Transcript: ENSMUST00000014927
AA Change: N646S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: N646S

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160191
AA Change: N577S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: N577S

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161672
Predicted Effect probably benign
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168196
Predicted Effect probably benign
Transcript: ENSMUST00000214056
AA Change: N682S

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,904,278 (GRCm39) V273M possibly damaging Het
Acin1 CCGC CC 14: 54,880,398 (GRCm39) probably null Het
Acvr1b T A 15: 101,091,857 (GRCm39) C46S probably damaging Het
Ahi1 A T 10: 20,846,818 (GRCm39) H416L possibly damaging Het
Aspm T A 1: 139,406,072 (GRCm39) L1653Q probably damaging Het
Cacna1a G A 8: 85,313,824 (GRCm39) V1533M possibly damaging Het
Ccdc33 C T 9: 57,940,267 (GRCm39) E502K possibly damaging Het
Ctnnd1 C T 2: 84,447,133 (GRCm39) V371M probably damaging Het
Cyp2a12 A T 7: 26,735,888 (GRCm39) probably null Het
Dnai4 T A 4: 102,906,600 (GRCm39) S738C possibly damaging Het
Ep400 A G 5: 110,816,496 (GRCm39) V2675A probably damaging Het
Foxh1 T A 15: 76,552,929 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gpnmb C T 6: 49,033,139 (GRCm39) T539M probably benign Het
Hdac1-ps A G 17: 78,799,867 (GRCm39) E286G probably benign Het
Hspa9 A G 18: 35,085,724 (GRCm39) probably null Het
Hspg2 T C 4: 137,271,225 (GRCm39) L2454P probably damaging Het
Ift140 T A 17: 25,254,786 (GRCm39) I422N probably benign Het
Igkv6-32 T C 6: 70,051,207 (GRCm39) S50G probably benign Het
Il23r T A 6: 67,463,154 (GRCm39) Y113F probably benign Het
Kcnt1 A G 2: 25,793,434 (GRCm39) D636G probably benign Het
Klhl41 G A 2: 69,510,171 (GRCm39) W569* probably null Het
Klra4 T A 6: 130,039,110 (GRCm39) D94V probably damaging Het
Lca5 T A 9: 83,280,666 (GRCm39) H378L probably benign Het
Lhx8 T A 3: 154,027,281 (GRCm39) T254S probably damaging Het
Lrch3 C T 16: 32,734,767 (GRCm39) R86W probably damaging Het
Lrp2 T A 2: 69,354,397 (GRCm39) N477I probably damaging Het
Man2a1 T A 17: 65,019,266 (GRCm39) I710K probably benign Het
Ncor1 A T 11: 62,229,826 (GRCm39) Y881N probably damaging Het
Nhsl1 T A 10: 18,402,074 (GRCm39) V1100E probably damaging Het
Oprk1 T C 1: 5,659,519 (GRCm39) V83A probably benign Het
Or4p8 T C 2: 88,727,678 (GRCm39) T88A probably benign Het
Or5p62 A G 7: 107,771,915 (GRCm39) V12A probably benign Het
Or7g35 T C 9: 19,496,322 (GRCm39) V163A probably benign Het
Pacs1 C T 19: 5,195,169 (GRCm39) V472I probably benign Het
Pard3b T C 1: 62,383,272 (GRCm39) Y789H probably damaging Het
Pcdha2 T C 18: 37,073,844 (GRCm39) Y492H probably damaging Het
Pcnt T C 10: 76,216,106 (GRCm39) N2261D probably damaging Het
Pex5l A T 3: 33,012,945 (GRCm39) S15T probably damaging Het
Poc5 A T 13: 96,539,463 (GRCm39) M335L probably benign Het
Polr1a C T 6: 71,944,891 (GRCm39) R1316W possibly damaging Het
Pp2d1 T C 17: 53,814,873 (GRCm39) H617R probably benign Het
Pramel24 T A 4: 143,454,591 (GRCm39) S296R probably benign Het
Prpsap1 T C 11: 116,378,974 (GRCm39) K65E probably benign Het
Ptgfrn T C 3: 100,952,909 (GRCm39) E775G probably benign Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Rbbp8 C A 18: 11,854,747 (GRCm39) A324E probably benign Het
Rfx6 G T 10: 51,554,092 (GRCm39) G63* probably null Het
Rpl37a T C 1: 72,751,308 (GRCm39) M47T probably benign Het
Samm50 T G 15: 84,084,831 (GRCm39) N187K probably benign Het
Skic2 A G 17: 35,064,142 (GRCm39) probably null Het
Slamf9 T C 1: 172,303,799 (GRCm39) I48T possibly damaging Het
Slc2a12 A G 10: 22,577,931 (GRCm39) K576E probably damaging Het
Slc4a10 G A 2: 62,083,710 (GRCm39) G388S probably damaging Het
Smtn G T 11: 3,479,530 (GRCm39) N512K probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sspo A G 6: 48,455,258 (GRCm39) Y3040C probably damaging Het
Stat1 T A 1: 52,183,401 (GRCm39) V389E probably damaging Het
Sult5a1 A T 8: 123,872,161 (GRCm39) M227K probably damaging Het
Thsd4 T C 9: 59,964,325 (GRCm39) D389G probably damaging Het
Tnxb T C 17: 34,923,052 (GRCm39) V2545A possibly damaging Het
Tpo T A 12: 30,142,589 (GRCm39) I712F probably damaging Het
Trim62 T C 4: 128,803,204 (GRCm39) V418A probably damaging Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r66 T C 7: 84,657,093 (GRCm39) D104G probably benign Het
Wdr26 T C 1: 181,015,251 (GRCm39) I371V probably benign Het
Zfp273 T G 13: 67,974,298 (GRCm39) C475W probably damaging Het
Zfp738 G T 13: 67,821,182 (GRCm39) T55K probably damaging Het
Zmym2 A G 14: 57,183,971 (GRCm39) I978V probably benign Het
Other mutations in Plekhg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Plekhg4 APN 8 106,102,370 (GRCm39) missense probably benign 0.01
IGL00970:Plekhg4 APN 8 106,105,067 (GRCm39) missense probably benign 0.02
IGL01784:Plekhg4 APN 8 106,105,589 (GRCm39) missense probably damaging 1.00
IGL02063:Plekhg4 APN 8 106,105,884 (GRCm39) splice site probably benign
IGL02371:Plekhg4 APN 8 106,105,691 (GRCm39) splice site probably null
IGL02984:Plekhg4 UTSW 8 106,107,020 (GRCm39) missense probably damaging 1.00
R0013:Plekhg4 UTSW 8 106,102,028 (GRCm39) nonsense probably null
R0105:Plekhg4 UTSW 8 106,108,644 (GRCm39) missense possibly damaging 0.65
R0105:Plekhg4 UTSW 8 106,108,644 (GRCm39) missense possibly damaging 0.65
R0631:Plekhg4 UTSW 8 106,105,934 (GRCm39) missense probably damaging 1.00
R1078:Plekhg4 UTSW 8 106,108,309 (GRCm39) nonsense probably null
R1201:Plekhg4 UTSW 8 106,108,305 (GRCm39) missense probably damaging 1.00
R1222:Plekhg4 UTSW 8 106,105,742 (GRCm39) missense probably benign 0.03
R1418:Plekhg4 UTSW 8 106,105,742 (GRCm39) missense probably benign 0.03
R1459:Plekhg4 UTSW 8 106,108,431 (GRCm39) missense probably damaging 0.98
R1465:Plekhg4 UTSW 8 106,107,672 (GRCm39) splice site probably benign
R1558:Plekhg4 UTSW 8 106,108,467 (GRCm39) missense possibly damaging 0.73
R1637:Plekhg4 UTSW 8 106,108,413 (GRCm39) missense probably benign 0.08
R1757:Plekhg4 UTSW 8 106,108,293 (GRCm39) missense probably damaging 0.99
R1922:Plekhg4 UTSW 8 106,105,017 (GRCm39) missense probably damaging 1.00
R1961:Plekhg4 UTSW 8 106,108,096 (GRCm39) missense probably damaging 0.99
R2074:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2113:Plekhg4 UTSW 8 106,106,066 (GRCm39) missense probably damaging 1.00
R2124:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2196:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R2321:Plekhg4 UTSW 8 106,104,172 (GRCm39) missense probably benign 0.00
R2432:Plekhg4 UTSW 8 106,108,468 (GRCm39) missense probably benign 0.00
R2908:Plekhg4 UTSW 8 106,107,493 (GRCm39) missense probably damaging 1.00
R2910:Plekhg4 UTSW 8 106,103,084 (GRCm39) small deletion probably benign
R4179:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R4180:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R4513:Plekhg4 UTSW 8 106,107,034 (GRCm39) missense probably damaging 1.00
R4678:Plekhg4 UTSW 8 106,107,003 (GRCm39) nonsense probably null
R4946:Plekhg4 UTSW 8 106,108,628 (GRCm39) missense probably null 0.01
R5362:Plekhg4 UTSW 8 106,108,030 (GRCm39) missense possibly damaging 0.93
R5454:Plekhg4 UTSW 8 106,102,745 (GRCm39) critical splice donor site probably null
R5609:Plekhg4 UTSW 8 106,106,134 (GRCm39) critical splice donor site probably null
R5624:Plekhg4 UTSW 8 106,107,382 (GRCm39) missense probably damaging 0.99
R5806:Plekhg4 UTSW 8 106,105,542 (GRCm39) missense possibly damaging 0.85
R6297:Plekhg4 UTSW 8 106,104,472 (GRCm39) missense probably damaging 1.00
R7198:Plekhg4 UTSW 8 106,105,329 (GRCm39) missense probably damaging 1.00
R7443:Plekhg4 UTSW 8 106,107,499 (GRCm39) missense probably damaging 1.00
R7570:Plekhg4 UTSW 8 106,105,316 (GRCm39) missense possibly damaging 0.95
R7577:Plekhg4 UTSW 8 106,102,031 (GRCm39) missense probably benign
R7632:Plekhg4 UTSW 8 106,106,782 (GRCm39) missense probably damaging 1.00
R7782:Plekhg4 UTSW 8 106,104,399 (GRCm39) missense probably benign 0.14
R7958:Plekhg4 UTSW 8 106,103,281 (GRCm39) missense possibly damaging 0.86
R8239:Plekhg4 UTSW 8 106,107,546 (GRCm39) nonsense probably null
R8335:Plekhg4 UTSW 8 106,102,848 (GRCm39) missense probably damaging 0.97
R8411:Plekhg4 UTSW 8 106,103,961 (GRCm39) nonsense probably null
R9011:Plekhg4 UTSW 8 106,102,284 (GRCm39) missense probably benign 0.23
R9017:Plekhg4 UTSW 8 106,105,332 (GRCm39) missense possibly damaging 0.85
R9255:Plekhg4 UTSW 8 106,103,271 (GRCm39) missense probably benign 0.00
R9297:Plekhg4 UTSW 8 106,105,907 (GRCm39) missense probably damaging 1.00
R9391:Plekhg4 UTSW 8 106,106,043 (GRCm39) missense probably damaging 1.00
R9524:Plekhg4 UTSW 8 106,101,398 (GRCm39) missense unknown
R9613:Plekhg4 UTSW 8 106,107,620 (GRCm39) missense probably damaging 1.00
R9683:Plekhg4 UTSW 8 106,102,923 (GRCm39) missense probably benign 0.00
Z1177:Plekhg4 UTSW 8 106,101,474 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TACTGACAGAGCTGGAGCAG -3'
(R):5'- GTCAGAGCTGCCTGAAAGAG -3'

Sequencing Primer
(F):5'- AGCTGCACTGGACCAGAC -3'
(R):5'- AGGAGACGACCTGGGCC -3'
Posted On 2016-07-22