Incidental Mutation 'R5223:Nhsl1'
ID402440
Institutional Source Beutler Lab
Gene Symbol Nhsl1
Ensembl Gene ENSMUSG00000039835
Gene NameNHS-like 1
Synonyms5730409E15Rik, D10Bwg0940e, A630035H13Rik
MMRRC Submission 042796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5223 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18318985-18533892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18526326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1100 (V1100E)
Ref Sequence ENSEMBL: ENSMUSP00000147021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037341] [ENSMUST00000100054] [ENSMUST00000162891] [ENSMUST00000207038]
Predicted Effect probably damaging
Transcript: ENSMUST00000037341
AA Change: V1070E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040799
Gene: ENSMUSG00000039835
AA Change: V1070E

DomainStartEndE-ValueType
Pfam:NHS 258 906 1.6e-246 PFAM
low complexity region 918 938 N/A INTRINSIC
low complexity region 942 950 N/A INTRINSIC
low complexity region 958 970 N/A INTRINSIC
low complexity region 992 1024 N/A INTRINSIC
low complexity region 1171 1197 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
low complexity region 1442 1460 N/A INTRINSIC
low complexity region 1484 1503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100054
AA Change: V1066E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097631
Gene: ENSMUSG00000039835
AA Change: V1066E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 7.3e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
low complexity region 938 946 N/A INTRINSIC
low complexity region 954 966 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
low complexity region 1167 1193 N/A INTRINSIC
low complexity region 1369 1381 N/A INTRINSIC
low complexity region 1438 1456 N/A INTRINSIC
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159299
SMART Domains Protein: ENSMUSP00000124629
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162891
SMART Domains Protein: ENSMUSP00000124072
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 2.1e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207038
AA Change: V1100E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Gpnmb C T 6: 49,056,205 T539M probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pacs1 C T 19: 5,145,141 V472I probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbbp8 C A 18: 11,721,690 A324E probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Slc4a10 G A 2: 62,253,366 G388S probably damaging Het
Smtn G T 11: 3,529,530 N512K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Tpo T A 12: 30,092,590 I712F probably damaging Het
Trim62 T C 4: 128,909,411 V418A probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zfp738 G T 13: 67,673,063 T55K probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Nhsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Nhsl1 APN 10 18527609 missense probably benign 0.07
IGL01121:Nhsl1 APN 10 18511710 missense probably damaging 1.00
IGL01775:Nhsl1 APN 10 18524474 missense probably damaging 0.99
IGL02143:Nhsl1 APN 10 18511635 missense possibly damaging 0.74
IGL02606:Nhsl1 APN 10 18511637 missense probably damaging 1.00
IGL02642:Nhsl1 APN 10 18408390 missense possibly damaging 0.96
IGL02866:Nhsl1 APN 10 18527607 missense probably damaging 0.99
IGL03263:Nhsl1 APN 10 18498079 nonsense probably null
IGL03380:Nhsl1 APN 10 18523879 nonsense probably null
PIT4651001:Nhsl1 UTSW 10 18408435 missense probably damaging 0.98
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0116:Nhsl1 UTSW 10 18525242 nonsense probably null
R0245:Nhsl1 UTSW 10 18525108 missense probably damaging 1.00
R0254:Nhsl1 UTSW 10 18472985 missense probably damaging 1.00
R0288:Nhsl1 UTSW 10 18524046 missense probably damaging 1.00
R0648:Nhsl1 UTSW 10 18531726 missense possibly damaging 0.92
R1055:Nhsl1 UTSW 10 18525475 missense probably benign 0.08
R1300:Nhsl1 UTSW 10 18408461 missense probably benign
R1384:Nhsl1 UTSW 10 18408513 missense probably null 0.96
R1453:Nhsl1 UTSW 10 18531575 missense probably damaging 1.00
R1523:Nhsl1 UTSW 10 18408355 missense probably benign
R1595:Nhsl1 UTSW 10 18526348 missense probably damaging 0.98
R1786:Nhsl1 UTSW 10 18524664 missense probably benign 0.28
R1836:Nhsl1 UTSW 10 18524905 missense possibly damaging 0.87
R1878:Nhsl1 UTSW 10 18524279 missense probably damaging 1.00
R2013:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2014:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2015:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R3115:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3116:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3754:Nhsl1 UTSW 10 18516034 missense probably damaging 0.99
R4342:Nhsl1 UTSW 10 18526689 missense probably damaging 1.00
R4595:Nhsl1 UTSW 10 18527609 missense probably benign 0.07
R4604:Nhsl1 UTSW 10 18531410 missense probably damaging 0.99
R4666:Nhsl1 UTSW 10 18531405 missense probably damaging 1.00
R5258:Nhsl1 UTSW 10 18524322 nonsense probably null
R5707:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R5796:Nhsl1 UTSW 10 18524250 missense probably benign 0.06
R5960:Nhsl1 UTSW 10 18526976 missense probably benign
R6190:Nhsl1 UTSW 10 18470041 intron probably benign
R6272:Nhsl1 UTSW 10 18524505 missense probably benign 0.01
R6677:Nhsl1 UTSW 10 18525862 missense probably damaging 0.98
R6714:Nhsl1 UTSW 10 18524711 missense possibly damaging 0.74
R6765:Nhsl1 UTSW 10 18531314 missense probably benign 0.01
R6892:Nhsl1 UTSW 10 18524343 missense probably damaging 1.00
R7049:Nhsl1 UTSW 10 18531638 missense probably damaging 0.99
R7060:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R7236:Nhsl1 UTSW 10 18525764 missense probably damaging 1.00
R7299:Nhsl1 UTSW 10 18527671 splice site probably null
R7305:Nhsl1 UTSW 10 18531686 missense possibly damaging 0.94
R7513:Nhsl1 UTSW 10 18523952 missense probably damaging 1.00
R7566:Nhsl1 UTSW 10 18516119 missense probably damaging 1.00
R8008:Nhsl1 UTSW 10 18408438 missense probably damaging 0.96
R8135:Nhsl1 UTSW 10 18531432 missense probably damaging 1.00
R8240:Nhsl1 UTSW 10 18526739 missense probably benign 0.34
R8391:Nhsl1 UTSW 10 18524943 missense possibly damaging 0.67
R8396:Nhsl1 UTSW 10 18525162 missense probably benign 0.00
Z1177:Nhsl1 UTSW 10 18526589 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGATCCTTGCCTCCTGTGC -3'
(R):5'- ACTGCACTGTCATGGTCAC -3'

Sequencing Primer
(F):5'- TGTGCCAGCACCTCCAC -3'
(R):5'- TCTTGGCAGGCATCGGAAG -3'
Posted On2016-07-22