Mutagenetix > Incidental Mutations

Incidental Mutation 'R5223:Ahi1'

402441

Institutional Source

Beutler Lab

Gene Symbol

Ahi1

Ensembl Gene

ENSMUSG00000019986

Gene Name

Abelson helper integration site 1

Synonyms

1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.850) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20952547-21080429 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20970919 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 416 (H416L)

Ref Sequence

ENSEMBL: ENSMUSP00000149010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]

Predicted Effect

probably benign
Transcript: ENSMUST00000105525
AA Change: H416L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: H416L

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	85	106	N/A	INTRINSIC
low complexity region	148	159	N/A	INTRINSIC
WD40	448	490	4.3e-1	SMART
WD40	493	532	9.3e-9	SMART
WD40	537	576	2.48e-4	SMART
WD40	583	622	6.09e-4	SMART
WD40	641	678	1.9e2	SMART
WD40	684	721	3.98e0	SMART
WD40	724	769	9.51e1	SMART
SH3	905	961	2.15e-21	SMART
low complexity region	975	989	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213104
AA Change: H416L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Ahi1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ahi1	APN	10	20972141	missense	probably damaging	1.00
IGL00914:Ahi1	APN	10	20984299	splice site	probably null
IGL01075:Ahi1	APN	10	20987025	missense	possibly damaging	0.80
IGL01094:Ahi1	APN	10	20972060	missense	probably damaging	0.99
IGL01128:Ahi1	APN	10	21074433	missense	probably benign
IGL01527:Ahi1	APN	10	20960085	splice site	probably benign
IGL01821:Ahi1	APN	10	21041243	critical splice donor site	probably null
IGL02159:Ahi1	APN	10	21058177	missense	probably benign	0.13
IGL02176:Ahi1	APN	10	20970916	missense	probably benign	0.00
IGL02200:Ahi1	APN	10	20981314	splice site	probably benign
IGL02232:Ahi1	APN	10	20981375	missense	probably damaging	1.00
IGL02305:Ahi1	APN	10	20970897	missense	probably benign	0.00
IGL02323:Ahi1	APN	10	20972034	missense	probably damaging	1.00
IGL02885:Ahi1	APN	10	21055113	missense	possibly damaging	0.61
IGL02958:Ahi1	APN	10	20963799	missense	probably damaging	1.00
IGL02971:Ahi1	APN	10	21000551	missense	possibly damaging	0.93
IGL03109:Ahi1	APN	10	20970942	missense	probably benign	0.00
IGL03192:Ahi1	APN	10	20965635	missense	probably benign	0.00
IGL03377:Ahi1	APN	10	21018004	missense	possibly damaging	0.51
arisen	UTSW	10	21007768	missense	possibly damaging	0.53
urspringt	UTSW	10	20984393	missense	probably damaging	1.00
P4717OSA:Ahi1	UTSW	10	20972110	missense	probably damaging	1.00
P4748:Ahi1	UTSW	10	20972110	missense	probably damaging	1.00
R0448:Ahi1	UTSW	10	20972075	missense	probably damaging	1.00
R0559:Ahi1	UTSW	10	21000719	splice site	probably benign
R0627:Ahi1	UTSW	10	20965522	missense	probably benign	0.10
R0652:Ahi1	UTSW	10	20979461	missense	probably damaging	1.00
R0690:Ahi1	UTSW	10	20970843	splice site	probably benign
R1209:Ahi1	UTSW	10	20963730	missense	probably damaging	0.98
R1364:Ahi1	UTSW	10	20972156	missense	probably damaging	0.97
R1510:Ahi1	UTSW	10	20959800	missense	probably benign	0.00
R1634:Ahi1	UTSW	10	20965693	missense	probably damaging	1.00
R1789:Ahi1	UTSW	10	20963115	missense	probably benign	0.18
R1818:Ahi1	UTSW	10	20988562	missense	probably damaging	1.00
R2069:Ahi1	UTSW	10	20959996	missense	probably damaging	0.98
R2148:Ahi1	UTSW	10	20970976	missense	possibly damaging	0.64
R2566:Ahi1	UTSW	10	20970911	nonsense	probably null
R2850:Ahi1	UTSW	10	21000593	missense	probably benign	0.07
R2862:Ahi1	UTSW	10	20981408	missense	probably damaging	0.99
R3969:Ahi1	UTSW	10	20959947	missense	probably damaging	1.00
R4430:Ahi1	UTSW	10	20972078	missense	probably damaging	1.00
R4496:Ahi1	UTSW	10	20965545	missense	probably benign	0.07
R4755:Ahi1	UTSW	10	21055047	missense	possibly damaging	0.94
R4916:Ahi1	UTSW	10	20984404	missense	probably damaging	1.00
R5216:Ahi1	UTSW	10	20960076	missense	probably benign	0.00
R5224:Ahi1	UTSW	10	20987022	missense	probably damaging	1.00
R5604:Ahi1	UTSW	10	20987005	missense	probably damaging	1.00
R5665:Ahi1	UTSW	10	21055047	missense	possibly damaging	0.94
R5704:Ahi1	UTSW	10	21074427	missense	probably benign
R5769:Ahi1	UTSW	10	20960082	critical splice donor site	probably null
R5899:Ahi1	UTSW	10	21000566	missense	probably benign	0.06
R5936:Ahi1	UTSW	10	20965933	missense	probably damaging	1.00
R5969:Ahi1	UTSW	10	20984393	missense	probably damaging	1.00
R6066:Ahi1	UTSW	10	20959926	missense	possibly damaging	0.84
R6122:Ahi1	UTSW	10	21058165	missense	probably benign	0.26
R6135:Ahi1	UTSW	10	20969121	missense	probably benign	0.01
R6240:Ahi1	UTSW	10	20977081	missense	probably damaging	1.00
R6387:Ahi1	UTSW	10	20969043	missense	probably damaging	1.00
R6395:Ahi1	UTSW	10	20979592	missense	possibly damaging	0.49
R6406:Ahi1	UTSW	10	20977049	missense	probably damaging	1.00
R6440:Ahi1	UTSW	10	20960082	critical splice donor site	probably benign
R6558:Ahi1	UTSW	10	20963673	missense	probably damaging	1.00
R6744:Ahi1	UTSW	10	20965567	missense	probably damaging	1.00
R6755:Ahi1	UTSW	10	21017913	missense	probably damaging	0.98
R6927:Ahi1	UTSW	10	21055069	missense	probably damaging	1.00
R6932:Ahi1	UTSW	10	20963691	missense	probably benign	0.02
R6967:Ahi1	UTSW	10	20988625	missense	probably damaging	0.98
R7168:Ahi1	UTSW	10	21017932	missense	probably benign	0.01
R7169:Ahi1	UTSW	10	21055019	missense	probably damaging	1.00
R7327:Ahi1	UTSW	10	20987077	missense	probably damaging	0.99
R7351:Ahi1	UTSW	10	20965933	missense	probably damaging	1.00
R7489:Ahi1	UTSW	10	20963750	missense	probably benign	0.35
R7680:Ahi1	UTSW	10	21007768	missense	possibly damaging	0.53
R7878:Ahi1	UTSW	10	20981431	critical splice donor site	probably null
R7999:Ahi1	UTSW	10	20965681	missense	probably benign	0.31
R8219:Ahi1	UTSW	10	21074436	missense	probably benign	0.00
R8248:Ahi1	UTSW	10	20972092	missense	probably benign	0.04
R8560:Ahi1	UTSW	10	20959915	missense	probably benign	0.04
R8926:Ahi1	UTSW	10	21055083	missense	probably damaging	1.00
X0024:Ahi1	UTSW	10	21000592	missense	possibly damaging	0.69
Z1177:Ahi1	UTSW	10	21041007	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGCCAGTTCCCACAAGTG -3'
(R):5'- CTGTGGATAATTATTGTCAGCCG -3'

Sequencing Primer
(F):5'- AGTTCCCACAAGTGTGCCATG -3'
(R):5'- GTCAGCCGACAGTAAGCAGC -3'

Posted On

2016-07-22