Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Rfx6'

402443

Institutional Source

Beutler Lab

Gene Symbol

Rfx6

Ensembl Gene

ENSMUSG00000019900

Gene Name

regulatory factor X, 6

Synonyms

Rfxdc1, 4930572O07Rik

MMRRC Submission

042796-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51677756-51730432 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 51677996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 63 (G63*)

Ref Sequence

ENSEMBL: ENSMUSP00000151430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122922] [ENSMUST00000219364]

AlphaFold

Q8C7R7

Predicted Effect

probably null
Transcript: ENSMUST00000122922
AA Change: G63*

SMART Domains

Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: G63*

Domain	Start	End	E-Value	Type
Pfam:RFX_DNA_binding	120	198	1.9e-33	PFAM
Blast:HisKA	355	417	2e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125729

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217662

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219017

Predicted Effect

probably null
Transcript: ENSMUST00000219364
AA Change: G63*

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Rfx6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Rfx6	APN	10	51681886	missense	probably damaging	1.00
IGL00816:Rfx6	APN	10	51678405	missense	probably benign	0.16
IGL01639:Rfx6	APN	10	51715906	nonsense	probably null
IGL01721:Rfx6	APN	10	51723077	missense	probably damaging	1.00
IGL01861:Rfx6	APN	10	51721579	missense	probably damaging	1.00
IGL02103:Rfx6	APN	10	51726856	missense	possibly damaging	0.93
IGL02113:Rfx6	APN	10	51678012	missense	probably benign
IGL02479:Rfx6	APN	10	51678328	missense	probably benign	0.07
IGL02592:Rfx6	APN	10	51716023	missense	probably damaging	1.00
IGL02635:Rfx6	APN	10	51716026	missense	possibly damaging	0.80
IGL02891:Rfx6	APN	10	51723846	missense	possibly damaging	0.64
IGL03153:Rfx6	APN	10	51723121	nonsense	probably null
IGL03263:Rfx6	APN	10	51725807	missense	probably benign	0.00
IGL03373:Rfx6	APN	10	51720000	missense	probably damaging	0.99
bulky	UTSW	10	51678333	missense	probably benign	0.00
R0060:Rfx6	UTSW	10	51677840	missense	probably benign	0.00
R0433:Rfx6	UTSW	10	51720028	missense	probably damaging	1.00
R1329:Rfx6	UTSW	10	51693737	missense	probably damaging	1.00
R1709:Rfx6	UTSW	10	51678402	missense	possibly damaging	0.64
R1820:Rfx6	UTSW	10	51723125	critical splice donor site	probably null
R2017:Rfx6	UTSW	10	51721604	missense	possibly damaging	0.50
R2020:Rfx6	UTSW	10	51720057	critical splice donor site	probably null
R2044:Rfx6	UTSW	10	51718126	missense	probably benign	0.16
R2495:Rfx6	UTSW	10	51726675	splice site	probably benign
R2655:Rfx6	UTSW	10	51693777	splice site	probably benign
R2912:Rfx6	UTSW	10	51718130	missense	probably damaging	1.00
R3159:Rfx6	UTSW	10	51726720	missense	probably damaging	1.00
R4036:Rfx6	UTSW	10	51726746	missense	probably damaging	1.00
R4536:Rfx6	UTSW	10	51723784	missense	probably benign	0.16
R4791:Rfx6	UTSW	10	51719944	splice site	probably null
R4945:Rfx6	UTSW	10	51726851	nonsense	probably null
R5233:Rfx6	UTSW	10	51712091	nonsense	probably null
R5448:Rfx6	UTSW	10	51683637	missense	probably damaging	1.00
R5600:Rfx6	UTSW	10	51723061	missense	probably damaging	1.00
R5768:Rfx6	UTSW	10	51726880	missense	probably damaging	0.99
R5858:Rfx6	UTSW	10	51725868	missense	probably benign	0.00
R5949:Rfx6	UTSW	10	51678333	missense	probably benign	0.00
R6001:Rfx6	UTSW	10	51718211	splice site	probably null
R6003:Rfx6	UTSW	10	51708587	missense	probably damaging	1.00
R6118:Rfx6	UTSW	10	51711866	missense	possibly damaging	0.91
R6629:Rfx6	UTSW	10	51725490	missense	probably benign	0.02
R6876:Rfx6	UTSW	10	51719991	missense	probably damaging	1.00
R6894:Rfx6	UTSW	10	51716039	missense	probably damaging	1.00
R6912:Rfx6	UTSW	10	51723853	missense	probably benign	0.00
R7130:Rfx6	UTSW	10	51678380	nonsense	probably null
R7574:Rfx6	UTSW	10	51681818	missense	probably benign	0.17
R7845:Rfx6	UTSW	10	51678026	missense	probably benign	0.05
R8188:Rfx6	UTSW	10	51718196	missense	probably benign	0.05
R8338:Rfx6	UTSW	10	51718094	missense	probably damaging	0.96
R8710:Rfx6	UTSW	10	51725405	missense	probably damaging	1.00
R8716:Rfx6	UTSW	10	51681872	missense	probably damaging	1.00
R8982:Rfx6	UTSW	10	51723819	missense	probably benign	0.14
R9104:Rfx6	UTSW	10	51723010	missense	probably damaging	1.00
R9154:Rfx6	UTSW	10	51721504	missense	probably benign	0.01
R9188:Rfx6	UTSW	10	51718167	missense	probably benign	0.04
R9388:Rfx6	UTSW	10	51678021	missense	possibly damaging	0.60
V8831:Rfx6	UTSW	10	51718208	critical splice donor site	probably null
X0023:Rfx6	UTSW	10	51678411	missense	probably damaging	1.00
Z1176:Rfx6	UTSW	10	51718093	missense	probably benign	0.05
Z1176:Rfx6	UTSW	10	51725831	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTACACAGAGCTCCTTCAAGC -3'
(R):5'- GAAGGAGTTGAGCAAAACCCTC -3'

Sequencing Primer
(F):5'- TGGCTAAGGTCCGGGAACTG -3'
(R):5'- CATAGTTAACAGTGTTCCTGCTG -3'

Posted On

2016-07-22