Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Gad1-ps'

402445

Institutional Source

Beutler Lab

Gene Symbol

Gad1-ps

Ensembl Gene

ENSMUSG00000090665

Gene Name

glutamate decarboxylase 1, pseudogene

Synonyms

Gad-1ps

MMRRC Submission

042796-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99443838-99447029 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

G to A at 99445147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167243

SMART Domains

Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	1	368	4.3e-153	PFAM
Pfam:Beta_elim_lyase	91	436	7.3e-8	PFAM
Pfam:Aminotran_5	130	370	4.7e-7	PFAM

Meta Mutation Damage Score

0.2911

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Gad1-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00963:Gad1-ps	APN	10	99445448	exon	noncoding transcript
IGL01301:Gad1-ps	APN	10	99445151	exon	noncoding transcript
IGL01394:Gad1-ps	APN	10	99445562	exon	noncoding transcript
IGL02220:Gad1-ps	APN	10	99445322	exon	noncoding transcript
IGL02240:Gad1-ps	APN	10	99444958	exon	noncoding transcript
IGL03406:Gad1-ps	APN	10	99444779	exon	noncoding transcript
ANU18:Gad1-ps	UTSW	10	99445151	exon	noncoding transcript
R0305:Gad1-ps	UTSW	10	99444803	exon	noncoding transcript
R0446:Gad1-ps	UTSW	10	99445521	exon	noncoding transcript
R0538:Gad1-ps	UTSW	10	99444992	exon	noncoding transcript
R1511:Gad1-ps	UTSW	10	99445469	exon	noncoding transcript
R1734:Gad1-ps	UTSW	10	99445775	exon	noncoding transcript
R1745:Gad1-ps	UTSW	10	99445524	exon	noncoding transcript
R1886:Gad1-ps	UTSW	10	99445582	exon	noncoding transcript
R3111:Gad1-ps	UTSW	10	99444521	exon	noncoding transcript
R3617:Gad1-ps	UTSW	10	99445398	exon	noncoding transcript
R5042:Gad1-ps	UTSW	10	99445654	exon	noncoding transcript
R5234:Gad1-ps	UTSW	10	99445326	exon	noncoding transcript
R5275:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5295:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5334:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5335:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5336:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5337:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5396:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5397:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5399:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5428:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5429:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5431:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5661:Gad1-ps	UTSW	10	99445039	exon	noncoding transcript
R5667:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5671:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5885:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5886:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGCTCTTGGCTTTGGAACAGAC -3'
(R):5'- AGGTAGCCTGCACACATCTG -3'

Sequencing Primer
(F):5'- CTCTTGGCTTTGGAACAGACAATGTG -3'
(R):5'- ACATCTGGCTGCATCCTTGGAG -3'

Posted On

2016-07-22