Incidental Mutation 'R5223:Smtn'
ID402446
Institutional Source Beutler Lab
Gene Symbol Smtn
Ensembl Gene ENSMUSG00000020439
Gene Namesmoothelin
Synonyms
MMRRC Submission 042796-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R5223 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3517523-3540612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3529530 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 512 (N512K)
Ref Sequence ENSEMBL: ENSMUSP00000133155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000110011] [ENSMUST00000136243] [ENSMUST00000156201] [ENSMUST00000170588]
AlphaFold Q921U8
Predicted Effect probably benign
Transcript: ENSMUST00000020718
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020721
AA Change: N512K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439
AA Change: N512K

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075118
AA Change: N512K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439
AA Change: N512K

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110011
AA Change: N512K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439
AA Change: N512K

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128806
Predicted Effect probably benign
Transcript: ENSMUST00000136243
SMART Domains Protein: ENSMUSP00000117307
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.3e-16 PFAM
Pfam:Smoothelin 68 122 6.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154861
Predicted Effect probably benign
Transcript: ENSMUST00000156201
SMART Domains Protein: ENSMUSP00000118750
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 3.4e-13 PFAM
Pfam:Smoothelin 68 122 1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170588
AA Change: N512K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439
AA Change: N512K

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Gpnmb C T 6: 49,056,205 T539M probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Nhsl1 T A 10: 18,526,326 V1100E probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pacs1 C T 19: 5,145,141 V472I probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbbp8 C A 18: 11,721,690 A324E probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Slc4a10 G A 2: 62,253,366 G388S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Tpo T A 12: 30,092,590 I712F probably damaging Het
Trim62 T C 4: 128,909,411 V418A probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zfp738 G T 13: 67,673,063 T55K probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Smtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Smtn APN 11 3526326 critical splice donor site probably null
IGL02335:Smtn APN 11 3526215 missense probably damaging 1.00
IGL02473:Smtn APN 11 3532463 missense probably damaging 1.00
IGL02678:Smtn APN 11 3526353 missense possibly damaging 0.95
IGL02824:Smtn APN 11 3532658 missense probably damaging 1.00
IGL03067:Smtn APN 11 3530165 missense possibly damaging 0.53
IGL03142:Smtn APN 11 3532601 nonsense probably null
runtish UTSW 11 3531326 missense possibly damaging 0.89
R0279:Smtn UTSW 11 3530235 missense probably damaging 0.99
R0523:Smtn UTSW 11 3524664 missense possibly damaging 0.89
R0855:Smtn UTSW 11 3521880 missense probably damaging 1.00
R1080:Smtn UTSW 11 3517693 missense probably damaging 1.00
R1218:Smtn UTSW 11 3530021 missense probably benign
R1571:Smtn UTSW 11 3530102 missense probably benign 0.00
R1899:Smtn UTSW 11 3531326 missense possibly damaging 0.89
R2033:Smtn UTSW 11 3517781 missense probably benign 0.43
R2126:Smtn UTSW 11 3530045 missense probably benign 0.02
R2358:Smtn UTSW 11 3532865 splice site probably null
R3690:Smtn UTSW 11 3527687 intron probably benign
R3712:Smtn UTSW 11 3532865 splice site probably null
R4108:Smtn UTSW 11 3526449 missense probably benign 0.10
R4709:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4710:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4830:Smtn UTSW 11 3520736 intron probably benign
R4944:Smtn UTSW 11 3522916 missense probably damaging 1.00
R4959:Smtn UTSW 11 3527825 start codon destroyed probably null
R5554:Smtn UTSW 11 3520811 nonsense probably null
R5610:Smtn UTSW 11 3529582 missense probably damaging 1.00
R5636:Smtn UTSW 11 3517829 critical splice acceptor site probably null
R5972:Smtn UTSW 11 3533486 missense probably damaging 1.00
R6108:Smtn UTSW 11 3529608 missense probably damaging 0.99
R6227:Smtn UTSW 11 3527624 intron probably benign
R7016:Smtn UTSW 11 3530368 critical splice donor site probably null
R7423:Smtn UTSW 11 3531200 critical splice donor site probably null
R7426:Smtn UTSW 11 3530249 missense probably benign 0.10
R7447:Smtn UTSW 11 3530196 missense probably benign
R7496:Smtn UTSW 11 3529988 missense probably damaging 0.99
R7716:Smtn UTSW 11 3524708 missense probably benign 0.00
R8762:Smtn UTSW 11 3526407 missense probably benign 0.00
R8925:Smtn UTSW 11 3529477 missense possibly damaging 0.68
R8927:Smtn UTSW 11 3529477 missense possibly damaging 0.68
R8932:Smtn UTSW 11 3522908 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGGACTATTAGTCTCTCTGGCC -3'
(R):5'- ACTCCTGATTCTGCTGGTGC -3'

Sequencing Primer
(F):5'- CTTTGTATGCACCATAGAGAATGCCC -3'
(R):5'- ACTGGCACTGCCTACATT -3'
Posted On2016-07-22