Mutagenetix > Incidental Mutations

Incidental Mutation 'R5223:Smtn'

402446

Institutional Source

Beutler Lab

Gene Symbol

Smtn

Ensembl Gene

ENSMUSG00000020439

Gene Name

smoothelin

Synonyms

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.467) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3517523-3540612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 3529530 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 512 (N512K)

Ref Sequence

ENSEMBL: ENSMUSP00000133155 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000110011] [ENSMUST00000136243] [ENSMUST00000156201] [ENSMUST00000170588]

AlphaFold

Q921U8

Predicted Effect

probably benign
Transcript: ENSMUST00000020718

SMART Domains

Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
low complexity region	26	38	N/A	INTRINSIC
coiled coil region	41	74	N/A	INTRINSIC
low complexity region	75	100	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
Pfam:Smoothelin	154	208	1e-23	PFAM
low complexity region	212	236	N/A	INTRINSIC
CH	322	421	1.04e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000020721
AA Change: N512K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439
AA Change: N512K

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	1.7e-15	PFAM
Pfam:Smoothelin	68	122	6.8e-19	PFAM
low complexity region	159	180	N/A	INTRINSIC
low complexity region	192	205	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	366	391	N/A	INTRINSIC
Pfam:Smoothelin	563	617	2.7e-23	PFAM
low complexity region	697	721	N/A	INTRINSIC
CH	807	906	1.04e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000075118
AA Change: N512K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439
AA Change: N512K

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	1.7e-15	PFAM
Pfam:Smoothelin	68	122	6.8e-19	PFAM
low complexity region	159	180	N/A	INTRINSIC
low complexity region	192	205	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	366	391	N/A	INTRINSIC
Pfam:Smoothelin	563	617	2.8e-23	PFAM
low complexity region	697	721	N/A	INTRINSIC
CH	807	907	9.51e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110011
AA Change: N512K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439
AA Change: N512K

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	2.5e-14	PFAM
Pfam:Smoothelin	72	122	8.5e-19	PFAM
low complexity region	159	180	N/A	INTRINSIC
low complexity region	192	205	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	366	391	N/A	INTRINSIC
Pfam:Smoothelin	568	617	6e-25	PFAM
low complexity region	697	721	N/A	INTRINSIC
CH	807	930	1.62e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123459

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128806

Predicted Effect

probably benign
Transcript: ENSMUST00000136243

SMART Domains

Protein: ENSMUSP00000117307
Gene: ENSMUSG00000020439

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	2.3e-16	PFAM
Pfam:Smoothelin	68	122	6.7e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154861

Predicted Effect

probably benign
Transcript: ENSMUST00000156201

SMART Domains

Protein: ENSMUSP00000118750
Gene: ENSMUSG00000020439

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	3.4e-13	PFAM
Pfam:Smoothelin	68	122	1e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170588
AA Change: N512K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439
AA Change: N512K

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	1.7e-15	PFAM
Pfam:Smoothelin	68	122	6.8e-19	PFAM
low complexity region	159	180	N/A	INTRINSIC
low complexity region	192	205	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	366	391	N/A	INTRINSIC
Pfam:Smoothelin	563	617	2.7e-23	PFAM
low complexity region	697	721	N/A	INTRINSIC
CH	807	906	1.04e-22	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Smtn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01124:Smtn	APN	11	3526326	critical splice donor site	probably null
IGL02335:Smtn	APN	11	3526215	missense	probably damaging	1.00
IGL02473:Smtn	APN	11	3532463	missense	probably damaging	1.00
IGL02678:Smtn	APN	11	3526353	missense	possibly damaging	0.95
IGL02824:Smtn	APN	11	3532658	missense	probably damaging	1.00
IGL03067:Smtn	APN	11	3530165	missense	possibly damaging	0.53
IGL03142:Smtn	APN	11	3532601	nonsense	probably null
runtish	UTSW	11	3531326	missense	possibly damaging	0.89
R0279:Smtn	UTSW	11	3530235	missense	probably damaging	0.99
R0523:Smtn	UTSW	11	3524664	missense	possibly damaging	0.89
R0855:Smtn	UTSW	11	3521880	missense	probably damaging	1.00
R1080:Smtn	UTSW	11	3517693	missense	probably damaging	1.00
R1218:Smtn	UTSW	11	3530021	missense	probably benign
R1571:Smtn	UTSW	11	3530102	missense	probably benign	0.00
R1899:Smtn	UTSW	11	3531326	missense	possibly damaging	0.89
R2033:Smtn	UTSW	11	3517781	missense	probably benign	0.43
R2126:Smtn	UTSW	11	3530045	missense	probably benign	0.02
R2358:Smtn	UTSW	11	3532865	splice site	probably null
R3690:Smtn	UTSW	11	3527687	intron	probably benign
R3712:Smtn	UTSW	11	3532865	splice site	probably null
R4108:Smtn	UTSW	11	3526449	missense	probably benign	0.10
R4709:Smtn	UTSW	11	3524663	missense	probably damaging	0.99
R4710:Smtn	UTSW	11	3524663	missense	probably damaging	0.99
R4830:Smtn	UTSW	11	3520736	intron	probably benign
R4944:Smtn	UTSW	11	3522916	missense	probably damaging	1.00
R4959:Smtn	UTSW	11	3527825	start codon destroyed	probably null
R5554:Smtn	UTSW	11	3520811	nonsense	probably null
R5610:Smtn	UTSW	11	3529582	missense	probably damaging	1.00
R5636:Smtn	UTSW	11	3517829	critical splice acceptor site	probably null
R5972:Smtn	UTSW	11	3533486	missense	probably damaging	1.00
R6108:Smtn	UTSW	11	3529608	missense	probably damaging	0.99
R6227:Smtn	UTSW	11	3527624	intron	probably benign
R7016:Smtn	UTSW	11	3530368	critical splice donor site	probably null
R7423:Smtn	UTSW	11	3531200	critical splice donor site	probably null
R7426:Smtn	UTSW	11	3530249	missense	probably benign	0.10
R7447:Smtn	UTSW	11	3530196	missense	probably benign
R7496:Smtn	UTSW	11	3529988	missense	probably damaging	0.99
R7716:Smtn	UTSW	11	3524708	missense	probably benign	0.00
R8762:Smtn	UTSW	11	3526407	missense	probably benign	0.00
R8925:Smtn	UTSW	11	3529477	missense	possibly damaging	0.68
R8927:Smtn	UTSW	11	3529477	missense	possibly damaging	0.68
R8932:Smtn	UTSW	11	3522908	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATGGACTATTAGTCTCTCTGGCC -3'
(R):5'- ACTCCTGATTCTGCTGGTGC -3'

Sequencing Primer
(F):5'- CTTTGTATGCACCATAGAGAATGCCC -3'
(R):5'- ACTGGCACTGCCTACATT -3'

Posted On

2016-07-22