Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Ncor1'

402447

Institutional Source

Beutler Lab

Gene Symbol

Ncor1

Ensembl Gene

ENSMUSG00000018501

Gene Name

nuclear receptor co-repressor 1

Synonyms

5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR

MMRRC Submission

042796-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62316426-62458541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62339000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 881 (Y881N)

Ref Sequence

ENSEMBL: ENSMUSP00000122654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000155712]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018645
AA Change: Y1611N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: Y1611N

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
Pfam:GPS2_interact	150	239	1.4e-37	PFAM
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000037575
AA Change: Y557N

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501
AA Change: Y557N

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
coiled coil region	658	695	N/A	INTRINSIC
low complexity region	780	794	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
PDB:3N00\|B	1010	1030	2e-7	PDB
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
PDB:2OVM\|B	1212	1235	2e-8	PDB
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101066
AA Change: Y1611N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: Y1611N

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101067
AA Change: Y1544N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: Y1544N

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	716	734	N/A	INTRINSIC
low complexity region	838	849	N/A	INTRINSIC
low complexity region	937	945	N/A	INTRINSIC
low complexity region	952	963	N/A	INTRINSIC
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1448	1459	N/A	INTRINSIC
coiled coil region	1645	1682	N/A	INTRINSIC
low complexity region	1767	1781	N/A	INTRINSIC
low complexity region	1902	1913	N/A	INTRINSIC
low complexity region	1969	1988	N/A	INTRINSIC
PDB:3N00\|B	1997	2017	4e-7	PDB
low complexity region	2019	2034	N/A	INTRINSIC
low complexity region	2089	2100	N/A	INTRINSIC
PDB:2OVM\|B	2199	2222	2e-8	PDB
low complexity region	2243	2256	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000155712
AA Change: Y881N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: Y881N

Domain	Start	End	E-Value	Type
low complexity region	26	47	N/A	INTRINSIC
low complexity region	87	104	N/A	INTRINSIC
low complexity region	204	215	N/A	INTRINSIC
low complexity region	303	311	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	352	365	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
coiled coil region	982	1019	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC
low complexity region	1239	1250	N/A	INTRINSIC
low complexity region	1306	1325	N/A	INTRINSIC
PDB:3N00\|B	1334	1354	3e-7	PDB
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1427	1438	N/A	INTRINSIC
PDB:2OVM\|B	1537	1560	2e-8	PDB
low complexity region	1581	1594	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000156740
AA Change: Y546N

SMART Domains

Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501
AA Change: Y546N

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
coiled coil region	647	684	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
low complexity region	905	916	N/A	INTRINSIC
low complexity region	972	991	N/A	INTRINSIC
PDB:3N00\|B	1000	1020	2e-7	PDB
low complexity region	1022	1037	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
PDB:2OVM\|B	1202	1225	2e-8	PDB
low complexity region	1246	1259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159224

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161432

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Ncor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Ncor1	APN	11	62392528	missense	probably damaging	1.00
IGL01343:Ncor1	APN	11	62325486	critical splice donor site	probably null
IGL01392:Ncor1	APN	11	62340594	missense	probably damaging	0.99
IGL01402:Ncor1	APN	11	62340474	missense	probably damaging	1.00
IGL01714:Ncor1	APN	11	62334584	missense	possibly damaging	0.58
IGL01772:Ncor1	APN	11	62349347	intron	probably benign
IGL01889:Ncor1	APN	11	62334601	missense	possibly damaging	0.69
IGL02058:Ncor1	APN	11	62344637	missense	probably damaging	1.00
IGL02065:Ncor1	APN	11	62419609	missense	possibly damaging	0.95
IGL02073:Ncor1	APN	11	62358917	missense	probably damaging	0.99
IGL02176:Ncor1	APN	11	62329659	unclassified	probably benign
IGL02288:Ncor1	APN	11	62349403	missense	probably benign	0.01
IGL02348:Ncor1	APN	11	62333659	splice site	probably benign
IGL02608:Ncor1	APN	11	62373214	missense	probably benign	0.07
laggard	UTSW	11	62369304	missense	probably damaging	1.00
Shortstep	UTSW	11	62334541	missense	probably damaging	1.00
LCD18:Ncor1	UTSW	11	62419782	critical splice acceptor site	probably benign
PIT4382001:Ncor1	UTSW	11	62344663	missense	probably damaging	0.96
PIT4576001:Ncor1	UTSW	11	62333717	missense	probably damaging	0.99
R0026:Ncor1	UTSW	11	62438429	missense	probably damaging	1.00
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0144:Ncor1	UTSW	11	62392595	missense	probably damaging	1.00
R0427:Ncor1	UTSW	11	62410920	missense	probably damaging	1.00
R0501:Ncor1	UTSW	11	62373322	missense	possibly damaging	0.73
R0544:Ncor1	UTSW	11	62333776	missense	probably damaging	1.00
R0544:Ncor1	UTSW	11	62333777	missense	probably damaging	1.00
R0563:Ncor1	UTSW	11	62343230	missense	probably damaging	0.97
R1074:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R1266:Ncor1	UTSW	11	62334040	missense	probably damaging	0.98
R1444:Ncor1	UTSW	11	62403806	missense	probably damaging	1.00
R1452:Ncor1	UTSW	11	62334631	missense	probably damaging	1.00
R1534:Ncor1	UTSW	11	62378504	missense	possibly damaging	0.92
R1710:Ncor1	UTSW	11	62423005	missense	probably damaging	1.00
R1762:Ncor1	UTSW	11	62384784	missense	possibly damaging	0.82
R1771:Ncor1	UTSW	11	62327112	missense	probably damaging	1.00
R1864:Ncor1	UTSW	11	62381419	missense	probably damaging	1.00
R1902:Ncor1	UTSW	11	62338158	missense	probably damaging	1.00
R1906:Ncor1	UTSW	11	62349385	missense	possibly damaging	0.81
R2009:Ncor1	UTSW	11	62325601	missense	probably benign	0.43
R3708:Ncor1	UTSW	11	62344687	missense	probably damaging	1.00
R3825:Ncor1	UTSW	11	62373357	missense	probably benign	0.00
R3923:Ncor1	UTSW	11	62325616	missense	probably damaging	1.00
R3966:Ncor1	UTSW	11	62344757	missense	probably damaging	1.00
R4049:Ncor1	UTSW	11	62329668	splice site	probably null
R4350:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4351:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4359:Ncor1	UTSW	11	62358910	missense	probably damaging	1.00
R4712:Ncor1	UTSW	11	62344834	missense	probably damaging	1.00
R4723:Ncor1	UTSW	11	62378612	missense	probably benign	0.26
R4863:Ncor1	UTSW	11	62392638	missense	possibly damaging	0.92
R4875:Ncor1	UTSW	11	62433611	small deletion	probably benign
R4956:Ncor1	UTSW	11	62340605	missense	probably damaging	1.00
R4993:Ncor1	UTSW	11	62343341	missense	probably damaging	1.00
R5079:Ncor1	UTSW	11	62345237	missense	possibly damaging	0.92
R5144:Ncor1	UTSW	11	62349464	missense	probably damaging	1.00
R5243:Ncor1	UTSW	11	62338962	missense	probably damaging	1.00
R5271:Ncor1	UTSW	11	62340545	missense	probably damaging	1.00
R5285:Ncor1	UTSW	11	62392649	missense	probably damaging	1.00
R5533:Ncor1	UTSW	11	62343011	missense	probably benign	0.00
R5580:Ncor1	UTSW	11	62389778	nonsense	probably null
R5593:Ncor1	UTSW	11	62369304	missense	probably damaging	1.00
R5609:Ncor1	UTSW	11	62358853	splice site	probably null
R5632:Ncor1	UTSW	11	62338234	missense	possibly damaging	0.85
R5830:Ncor1	UTSW	11	62344763	missense	possibly damaging	0.71
R5896:Ncor1	UTSW	11	62383190	missense	probably damaging	1.00
R5973:Ncor1	UTSW	11	62349310	splice site	probably null
R6013:Ncor1	UTSW	11	62321077	missense	probably benign
R6019:Ncor1	UTSW	11	62373161	missense	probably benign	0.00
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6075:Ncor1	UTSW	11	62317849	missense	probably damaging	1.00
R6091:Ncor1	UTSW	11	62419617	missense	probably damaging	0.98
R6248:Ncor1	UTSW	11	62366982	missense	probably damaging	1.00
R6281:Ncor1	UTSW	11	62373545	missense	possibly damaging	0.71
R6351:Ncor1	UTSW	11	62373298	missense	probably benign	0.30
R6469:Ncor1	UTSW	11	62343302	missense	probably damaging	1.00
R6502:Ncor1	UTSW	11	62381414	nonsense	probably null
R6614:Ncor1	UTSW	11	62330819	missense	probably benign	0.01
R6650:Ncor1	UTSW	11	62334541	missense	probably damaging	1.00
R6765:Ncor1	UTSW	11	62373446	missense	probably benign	0.01
R6852:Ncor1	UTSW	11	62343245	missense	probably damaging	0.97
R6909:Ncor1	UTSW	11	62329486	missense	probably damaging	1.00
R6965:Ncor1	UTSW	11	62353233	critical splice donor site	probably null
R7054:Ncor1	UTSW	11	62384793	missense	probably null
R7248:Ncor1	UTSW	11	62384772	missense	possibly damaging	0.89
R7352:Ncor1	UTSW	11	62333911	missense	probably damaging	0.99
R7396:Ncor1	UTSW	11	62343218	missense	probably damaging	0.99
R7434:Ncor1	UTSW	11	62383199	missense	probably damaging	0.99
R7552:Ncor1	UTSW	11	62373424	missense	possibly damaging	0.53
R7565:Ncor1	UTSW	11	62401265	missense	probably damaging	1.00
R7575:Ncor1	UTSW	11	62383256	missense	probably benign	0.21
R7622:Ncor1	UTSW	11	62317968	missense	probably benign	0.00
R7664:Ncor1	UTSW	11	62398328	missense	probably damaging	1.00
R7814:Ncor1	UTSW	11	62333926	missense	probably damaging	0.99
R7963:Ncor1	UTSW	11	62334533	missense	probably benign	0.28
R7990:Ncor1	UTSW	11	62349495	critical splice acceptor site	probably null
R8302:Ncor1	UTSW	11	62333855	missense	probably benign	0.00
R8334:Ncor1	UTSW	11	62383244	missense	probably damaging	0.99
R8512:Ncor1	UTSW	11	62433611	small deletion	probably benign
R8728:Ncor1	UTSW	11	62330859	missense	probably benign	0.04
R8777:Ncor1	UTSW	11	62433666	missense	probably benign	0.03
R8777:Ncor1	UTSW	11	62433668	missense	probably damaging	1.00
R8777-TAIL:Ncor1	UTSW	11	62433666	missense	probably benign	0.03
R8777-TAIL:Ncor1	UTSW	11	62433668	missense	probably damaging	1.00
R8821:Ncor1	UTSW	11	62369408	missense	probably benign	0.07
R8831:Ncor1	UTSW	11	62369408	missense	probably benign	0.07
R8988:Ncor1	UTSW	11	62343045	nonsense	probably null
R9111:Ncor1	UTSW	11	62389759	missense	possibly damaging	0.95
R9147:Ncor1	UTSW	11	62333846	missense	probably damaging	1.00
R9391:Ncor1	UTSW	11	62325550	nonsense	probably null
R9467:Ncor1	UTSW	11	62433611	small insertion	probably benign
R9467:Ncor1	UTSW	11	62433622	small insertion	probably benign
R9510:Ncor1	UTSW	11	62433616	small insertion	probably benign
R9511:Ncor1	UTSW	11	62433623	small insertion	probably benign
R9560:Ncor1	UTSW	11	62373122	missense	possibly damaging	0.96
R9687:Ncor1	UTSW	11	62369367	missense	possibly damaging	0.93
X0065:Ncor1	UTSW	11	62354569	critical splice donor site	probably null
X0065:Ncor1	UTSW	11	62358991	missense	probably benign	0.23
Z1176:Ncor1	UTSW	11	62438516	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTCTACAGAGGCAAGCATAACC -3'
(R):5'- AGTTCACTCAGCAGGTGTG -3'

Sequencing Primer
(F):5'- GGCAAGCATAACCTTCTTTTATGTC -3'
(R):5'- CAGGTGTGCTGCTTCCTCG -3'

Posted On

2016-07-22