Incidental Mutation 'R5223:Prpsap1'
ID 402449
Institutional Source Beutler Lab
Gene Symbol Prpsap1
Ensembl Gene ENSMUSG00000015869
Gene Name phosphoribosyl pyrophosphate synthetase-associated protein 1
Synonyms PAP39, 5730409F23Rik
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R5223 (G1)
Quality Score 209
Status Not validated
Chromosome 11
Chromosomal Location 116361671-116385461 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116378974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 65 (K65E)
Ref Sequence ENSEMBL: ENSMUSP00000119576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106391] [ENSMUST00000135196] [ENSMUST00000152496]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000106391
AA Change: K65E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101999
Gene: ENSMUSG00000015869
AA Change: K65E

DomainStartEndE-ValueType
low complexity region 5 34 N/A INTRINSIC
Pfam:Pribosyltran_N 38 155 4.8e-41 PFAM
Pfam:Pribosyl_synth 196 379 1.1e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130835
Predicted Effect probably benign
Transcript: ENSMUST00000135196
AA Change: K65E

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000119576
Gene: ENSMUSG00000015869
AA Change: K65E

DomainStartEndE-ValueType
low complexity region 5 34 N/A INTRINSIC
Pfam:Pribosyltran_N 38 160 2.9e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144154
Predicted Effect probably benign
Transcript: ENSMUST00000152496
AA Change: K29E

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115982
Gene: ENSMUSG00000015869
AA Change: K29E

DomainStartEndE-ValueType
Pfam:Pribosyltran_N 17 119 1.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152874
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,904,278 (GRCm39) V273M possibly damaging Het
Acin1 CCGC CC 14: 54,880,398 (GRCm39) probably null Het
Acvr1b T A 15: 101,091,857 (GRCm39) C46S probably damaging Het
Ahi1 A T 10: 20,846,818 (GRCm39) H416L possibly damaging Het
Aspm T A 1: 139,406,072 (GRCm39) L1653Q probably damaging Het
Cacna1a G A 8: 85,313,824 (GRCm39) V1533M possibly damaging Het
Ccdc33 C T 9: 57,940,267 (GRCm39) E502K possibly damaging Het
Ctnnd1 C T 2: 84,447,133 (GRCm39) V371M probably damaging Het
Cyp2a12 A T 7: 26,735,888 (GRCm39) probably null Het
Dnai4 T A 4: 102,906,600 (GRCm39) S738C possibly damaging Het
Ep400 A G 5: 110,816,496 (GRCm39) V2675A probably damaging Het
Foxh1 T A 15: 76,552,929 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gpnmb C T 6: 49,033,139 (GRCm39) T539M probably benign Het
Hdac1-ps A G 17: 78,799,867 (GRCm39) E286G probably benign Het
Hspa9 A G 18: 35,085,724 (GRCm39) probably null Het
Hspg2 T C 4: 137,271,225 (GRCm39) L2454P probably damaging Het
Ift140 T A 17: 25,254,786 (GRCm39) I422N probably benign Het
Igkv6-32 T C 6: 70,051,207 (GRCm39) S50G probably benign Het
Il23r T A 6: 67,463,154 (GRCm39) Y113F probably benign Het
Kcnt1 A G 2: 25,793,434 (GRCm39) D636G probably benign Het
Klhl41 G A 2: 69,510,171 (GRCm39) W569* probably null Het
Klra4 T A 6: 130,039,110 (GRCm39) D94V probably damaging Het
Lca5 T A 9: 83,280,666 (GRCm39) H378L probably benign Het
Lhx8 T A 3: 154,027,281 (GRCm39) T254S probably damaging Het
Lrch3 C T 16: 32,734,767 (GRCm39) R86W probably damaging Het
Lrp2 T A 2: 69,354,397 (GRCm39) N477I probably damaging Het
Man2a1 T A 17: 65,019,266 (GRCm39) I710K probably benign Het
Ncor1 A T 11: 62,229,826 (GRCm39) Y881N probably damaging Het
Nhsl1 T A 10: 18,402,074 (GRCm39) V1100E probably damaging Het
Oprk1 T C 1: 5,659,519 (GRCm39) V83A probably benign Het
Or4p8 T C 2: 88,727,678 (GRCm39) T88A probably benign Het
Or5p62 A G 7: 107,771,915 (GRCm39) V12A probably benign Het
Or7g35 T C 9: 19,496,322 (GRCm39) V163A probably benign Het
Pacs1 C T 19: 5,195,169 (GRCm39) V472I probably benign Het
Pard3b T C 1: 62,383,272 (GRCm39) Y789H probably damaging Het
Pcdha2 T C 18: 37,073,844 (GRCm39) Y492H probably damaging Het
Pcnt T C 10: 76,216,106 (GRCm39) N2261D probably damaging Het
Pex5l A T 3: 33,012,945 (GRCm39) S15T probably damaging Het
Plekhg4 A G 8: 106,105,581 (GRCm39) N682S probably benign Het
Poc5 A T 13: 96,539,463 (GRCm39) M335L probably benign Het
Polr1a C T 6: 71,944,891 (GRCm39) R1316W possibly damaging Het
Pp2d1 T C 17: 53,814,873 (GRCm39) H617R probably benign Het
Pramel24 T A 4: 143,454,591 (GRCm39) S296R probably benign Het
Ptgfrn T C 3: 100,952,909 (GRCm39) E775G probably benign Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Rbbp8 C A 18: 11,854,747 (GRCm39) A324E probably benign Het
Rfx6 G T 10: 51,554,092 (GRCm39) G63* probably null Het
Rpl37a T C 1: 72,751,308 (GRCm39) M47T probably benign Het
Samm50 T G 15: 84,084,831 (GRCm39) N187K probably benign Het
Skic2 A G 17: 35,064,142 (GRCm39) probably null Het
Slamf9 T C 1: 172,303,799 (GRCm39) I48T possibly damaging Het
Slc2a12 A G 10: 22,577,931 (GRCm39) K576E probably damaging Het
Slc4a10 G A 2: 62,083,710 (GRCm39) G388S probably damaging Het
Smtn G T 11: 3,479,530 (GRCm39) N512K probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sspo A G 6: 48,455,258 (GRCm39) Y3040C probably damaging Het
Stat1 T A 1: 52,183,401 (GRCm39) V389E probably damaging Het
Sult5a1 A T 8: 123,872,161 (GRCm39) M227K probably damaging Het
Thsd4 T C 9: 59,964,325 (GRCm39) D389G probably damaging Het
Tnxb T C 17: 34,923,052 (GRCm39) V2545A possibly damaging Het
Tpo T A 12: 30,142,589 (GRCm39) I712F probably damaging Het
Trim62 T C 4: 128,803,204 (GRCm39) V418A probably damaging Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r66 T C 7: 84,657,093 (GRCm39) D104G probably benign Het
Wdr26 T C 1: 181,015,251 (GRCm39) I371V probably benign Het
Zfp273 T G 13: 67,974,298 (GRCm39) C475W probably damaging Het
Zfp738 G T 13: 67,821,182 (GRCm39) T55K probably damaging Het
Zmym2 A G 14: 57,183,971 (GRCm39) I978V probably benign Het
Other mutations in Prpsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0042:Prpsap1 UTSW 11 116,370,482 (GRCm39) missense probably benign 0.42
R0684:Prpsap1 UTSW 11 116,362,317 (GRCm39) missense probably damaging 1.00
R1538:Prpsap1 UTSW 11 116,370,534 (GRCm39) missense probably benign 0.09
R2429:Prpsap1 UTSW 11 116,363,061 (GRCm39) missense probably damaging 1.00
R3415:Prpsap1 UTSW 11 116,369,410 (GRCm39) missense probably benign 0.01
R3417:Prpsap1 UTSW 11 116,369,410 (GRCm39) missense probably benign 0.01
R4035:Prpsap1 UTSW 11 116,363,834 (GRCm39) missense probably benign 0.17
R6216:Prpsap1 UTSW 11 116,362,239 (GRCm39) missense probably damaging 1.00
R6875:Prpsap1 UTSW 11 116,362,264 (GRCm39) missense probably damaging 1.00
R7086:Prpsap1 UTSW 11 116,368,109 (GRCm39) missense probably benign
R7159:Prpsap1 UTSW 11 116,384,870 (GRCm39) missense probably benign 0.26
R7999:Prpsap1 UTSW 11 116,381,042 (GRCm39) start codon destroyed probably null
R8414:Prpsap1 UTSW 11 116,369,439 (GRCm39) missense probably damaging 1.00
R8940:Prpsap1 UTSW 11 116,370,615 (GRCm39) missense probably damaging 0.98
R9364:Prpsap1 UTSW 11 116,385,015 (GRCm39) start gained probably benign
Z1176:Prpsap1 UTSW 11 116,370,594 (GRCm39) missense possibly damaging 0.89
Z1176:Prpsap1 UTSW 11 116,369,444 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GGCCTTGATGGACTATATAGTTAATGC -3'
(R):5'- TGCCTTGAGAAAGCTCCAC -3'

Sequencing Primer
(F):5'- AAGTGGCGGAGACTGCTTGTC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On 2016-07-22