Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Aatk'

402450

Institutional Source

Beutler Lab

Gene Symbol

Aatk

Ensembl Gene

ENSMUSG00000025375

Gene Name

apoptosis-associated tyrosine kinase

Synonyms

AATYK1

MMRRC Submission

042796-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R5223 (G1)

Quality Score

125

Status

Not validated

Chromosome

Chromosomal Location

120007313-120047167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 120013452 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 273 (V273M)

Ref Sequence

ENSEMBL: ENSMUSP00000099309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064307] [ENSMUST00000103019] [ENSMUST00000103020]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064307
AA Change: V330M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000067181
Gene: ENSMUSG00000025375
AA Change: V330M

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	30	49	N/A	INTRINSIC
Pfam:Pkinase_Tyr	135	405	3.9e-63	PFAM
Pfam:Pkinase	136	404	2.6e-33	PFAM
low complexity region	425	457	N/A	INTRINSIC
low complexity region	502	514	N/A	INTRINSIC
low complexity region	615	624	N/A	INTRINSIC
low complexity region	647	666	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC
low complexity region	808	819	N/A	INTRINSIC
low complexity region	913	927	N/A	INTRINSIC
low complexity region	934	943	N/A	INTRINSIC
low complexity region	985	1004	N/A	INTRINSIC
low complexity region	1063	1082	N/A	INTRINSIC
low complexity region	1085	1096	N/A	INTRINSIC
low complexity region	1160	1174	N/A	INTRINSIC
low complexity region	1179	1204	N/A	INTRINSIC
low complexity region	1319	1333	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083666

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103019
AA Change: V273M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099308
Gene: ENSMUSG00000025375
AA Change: V273M

Domain	Start	End	E-Value	Type
Pfam:Pkinase	78	347	3e-36	PFAM
Pfam:Pkinase_Tyr	78	348	1.9e-62	PFAM
low complexity region	368	400	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC
low complexity region	590	609	N/A	INTRINSIC
low complexity region	627	638	N/A	INTRINSIC
low complexity region	751	762	N/A	INTRINSIC
low complexity region	856	870	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC
low complexity region	928	947	N/A	INTRINSIC
low complexity region	1006	1025	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1103	1117	N/A	INTRINSIC
low complexity region	1122	1147	N/A	INTRINSIC
low complexity region	1262	1276	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103020
AA Change: V273M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099309
Gene: ENSMUSG00000025375
AA Change: V273M

Domain	Start	End	E-Value	Type
Pfam:Pkinase	78	347	3e-36	PFAM
Pfam:Pkinase_Tyr	78	348	1.9e-62	PFAM
low complexity region	368	400	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC
low complexity region	590	609	N/A	INTRINSIC
low complexity region	627	638	N/A	INTRINSIC
low complexity region	751	762	N/A	INTRINSIC
low complexity region	856	870	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC
low complexity region	928	947	N/A	INTRINSIC
low complexity region	1006	1025	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1103	1117	N/A	INTRINSIC
low complexity region	1122	1147	N/A	INTRINSIC
low complexity region	1262	1276	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128836

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134319

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142959

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198674

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased brain size, longer axons and fewer neurites. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Aatk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Aatk	APN	11	120010186	missense	probably benign	0.02
IGL00953:Aatk	APN	11	120011221	missense	probably benign	0.00
IGL01019:Aatk	APN	11	120012275	missense	probably benign
IGL01758:Aatk	APN	11	120010819	missense	possibly damaging	0.86
IGL02377:Aatk	APN	11	120046863	utr 5 prime	probably benign
IGL02902:Aatk	APN	11	120011777	missense	probably benign	0.00
IGL03067:Aatk	APN	11	120010083	missense	probably benign	0.00
IGL03116:Aatk	APN	11	120016751	missense	probably benign	0.14
IGL03279:Aatk	APN	11	120013678	missense	probably damaging	1.00
IGL03405:Aatk	APN	11	120016403	missense	probably benign	0.02
PIT4366001:Aatk	UTSW	11	120010960	missense	possibly damaging	0.55
PIT4802001:Aatk	UTSW	11	120011346	missense	probably benign
R0101:Aatk	UTSW	11	120010913	missense	probably benign	0.19
R0497:Aatk	UTSW	11	120018780	missense	probably damaging	0.99
R0535:Aatk	UTSW	11	120010193	missense	probably benign	0.00
R0638:Aatk	UTSW	11	120009922	missense	probably damaging	1.00
R0939:Aatk	UTSW	11	120012143	missense	probably damaging	0.99
R1475:Aatk	UTSW	11	120010888	missense	probably damaging	0.96
R1840:Aatk	UTSW	11	120013732	missense	probably damaging	1.00
R1865:Aatk	UTSW	11	120010222	missense	probably benign	0.00
R1982:Aatk	UTSW	11	120013514	missense	probably damaging	1.00
R2027:Aatk	UTSW	11	120009317	missense	probably damaging	1.00
R2115:Aatk	UTSW	11	120009736	missense	probably benign
R2220:Aatk	UTSW	11	120012177	missense	probably damaging	1.00
R2264:Aatk	UTSW	11	120010274	missense	probably damaging	1.00
R2504:Aatk	UTSW	11	120018855	missense	probably benign	0.00
R3872:Aatk	UTSW	11	120010219	missense	possibly damaging	0.71
R4551:Aatk	UTSW	11	120011569	missense	probably benign	0.03
R4657:Aatk	UTSW	11	120013478	missense	possibly damaging	0.69
R4744:Aatk	UTSW	11	120016122	missense	possibly damaging	0.64
R4924:Aatk	UTSW	11	120011525	missense	probably damaging	1.00
R5063:Aatk	UTSW	11	120010489	missense	probably benign	0.07
R5243:Aatk	UTSW	11	120016768	missense	probably damaging	1.00
R5376:Aatk	UTSW	11	120012034	missense	probably damaging	0.98
R5442:Aatk	UTSW	11	120018768	missense	probably benign	0.02
R5550:Aatk	UTSW	11	120009303	missense	probably benign	0.42
R5678:Aatk	UTSW	11	120010154	missense	probably benign	0.00
R5932:Aatk	UTSW	11	120021533	missense	probably damaging	1.00
R6026:Aatk	UTSW	11	120012364	missense	possibly damaging	0.65
R6129:Aatk	UTSW	11	120021533	missense	probably damaging	1.00
R6409:Aatk	UTSW	11	120011732	missense	probably benign	0.01
R6477:Aatk	UTSW	11	120018870	missense	probably benign	0.00
R6478:Aatk	UTSW	11	120010991	missense	probably benign	0.00
R6749:Aatk	UTSW	11	120010774	missense	possibly damaging	0.58
R6753:Aatk	UTSW	11	120010151	missense	probably benign
R6787:Aatk	UTSW	11	120010682	missense	probably damaging	1.00
R6852:Aatk	UTSW	11	120010468	missense	probably benign	0.10
R7114:Aatk	UTSW	11	120009619	missense	probably benign
R7557:Aatk	UTSW	11	120009430	missense	possibly damaging	0.73
R7818:Aatk	UTSW	11	120021455	missense	probably benign
R7954:Aatk	UTSW	11	120012343	missense	possibly damaging	0.51
R8176:Aatk	UTSW	11	120016415	missense	probably damaging	0.99
R8420:Aatk	UTSW	11	120046920	missense	unknown
R8963:Aatk	UTSW	11	120012137	missense	probably damaging	1.00
R9090:Aatk	UTSW	11	120011114	missense	probably damaging	0.98
R9167:Aatk	UTSW	11	120011126	missense	possibly damaging	0.90
R9271:Aatk	UTSW	11	120011114	missense	probably damaging	0.98
R9357:Aatk	UTSW	11	120010870	missense	probably benign	0.01
R9373:Aatk	UTSW	11	120015517	missense	possibly damaging	0.95
R9420:Aatk	UTSW	11	120021451	missense	probably benign	0.01
R9423:Aatk	UTSW	11	120010694	missense	probably damaging	1.00
R9476:Aatk	UTSW	11	120010268	missense	probably benign	0.01
R9510:Aatk	UTSW	11	120010268	missense	probably benign	0.01
R9519:Aatk	UTSW	11	120021483	start gained	probably benign
R9605:Aatk	UTSW	11	120011383	missense	possibly damaging	0.88
R9649:Aatk	UTSW	11	120010907	missense	probably damaging	1.00
R9766:Aatk	UTSW	11	120011739	missense	probably benign	0.00
X0064:Aatk	UTSW	11	120011176	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- CAGGCATGAGTACACTTTCCC -3'
(R):5'- CCTGTCGCATTGCAAATACAGG -3'

Sequencing Primer
(F):5'- CTGTGTGGCAGCCCTAATCCTAG -3'
(R):5'- TCGCATTGCAAATACAGGGTGAG -3'

Posted On

2016-07-22