Incidental Mutation 'R5223:Tpo'
ID 402451
Institutional Source Beutler Lab
Gene Symbol Tpo
Ensembl Gene ENSMUSG00000020673
Gene Name thyroid peroxidase
Synonyms
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R5223 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 30054659-30132624 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30092590 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 712 (I712F)
Ref Sequence ENSEMBL: ENSMUSP00000021005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021005]
AlphaFold P35419
Predicted Effect probably damaging
Transcript: ENSMUST00000021005
AA Change: I712F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021005
Gene: ENSMUSG00000020673
AA Change: I712F

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:An_peroxidase 145 697 4.2e-180 PFAM
CCP 730 782 1.26e-7 SMART
EGF_CA 784 827 3.51e-10 SMART
transmembrane domain 837 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140875
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein. The encoded enzyme plays a central role in thyroid gland function. The enzyme functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mice with homozygous missense mutations in this gene exhibit hypothyroid dwarfism and hearing impairment. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mice with a missense mutation exhibit hypothyroid dwarfism, including a goiter with colloid deficiency and abnormal follicle epithelium, reduced hematocrit and red blood cells and a lifespan of about 3 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Gpnmb C T 6: 49,056,205 T539M probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Nhsl1 T A 10: 18,526,326 V1100E probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pacs1 C T 19: 5,145,141 V472I probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbbp8 C A 18: 11,721,690 A324E probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Slc4a10 G A 2: 62,253,366 G388S probably damaging Het
Smtn G T 11: 3,529,530 N512K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Trim62 T C 4: 128,909,411 V418A probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zfp738 G T 13: 67,673,063 T55K probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Tpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tpo APN 12 30084620 missense probably damaging 1.00
IGL00694:Tpo APN 12 30105994 missense probably damaging 0.98
IGL01660:Tpo APN 12 30119400 splice site probably benign
IGL01939:Tpo APN 12 30084647 missense possibly damaging 0.83
IGL02624:Tpo APN 12 30100414 missense probably benign 0.40
IGL03268:Tpo APN 12 30094965 missense possibly damaging 0.82
IGL03330:Tpo APN 12 30103501 missense probably damaging 0.97
IGL03138:Tpo UTSW 12 30074171 missense probably benign 0.00
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0076:Tpo UTSW 12 30104023 missense probably damaging 1.00
R0472:Tpo UTSW 12 30100486 missense probably benign 0.03
R1389:Tpo UTSW 12 30103110 missense probably damaging 0.98
R1493:Tpo UTSW 12 30131809 missense possibly damaging 0.78
R1526:Tpo UTSW 12 30084695 missense probably damaging 0.99
R1674:Tpo UTSW 12 30100568 missense probably benign 0.16
R1689:Tpo UTSW 12 30098246 missense probably damaging 1.00
R1986:Tpo UTSW 12 30119466 missense probably damaging 1.00
R2381:Tpo UTSW 12 30131827 missense possibly damaging 0.67
R2484:Tpo UTSW 12 30103969 missense probably benign 0.12
R2902:Tpo UTSW 12 30119449 missense possibly damaging 0.91
R4105:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4106:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4107:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4108:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4109:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4374:Tpo UTSW 12 30103152 missense possibly damaging 0.50
R4425:Tpo UTSW 12 30104016 missense probably damaging 1.00
R4600:Tpo UTSW 12 30098229 missense probably benign 0.32
R4668:Tpo UTSW 12 30103290 missense probably benign 0.03
R4758:Tpo UTSW 12 30075871 missense probably damaging 1.00
R4838:Tpo UTSW 12 30092634 missense probably damaging 1.00
R4869:Tpo UTSW 12 30103365 missense probably benign 0.00
R5163:Tpo UTSW 12 30105980 missense probably benign 0.00
R5367:Tpo UTSW 12 30103290 missense probably damaging 1.00
R5658:Tpo UTSW 12 30055138 missense possibly damaging 0.95
R5660:Tpo UTSW 12 30100496 missense possibly damaging 0.92
R5671:Tpo UTSW 12 30119491 missense probably benign 0.00
R6019:Tpo UTSW 12 30094981 missense possibly damaging 0.94
R6074:Tpo UTSW 12 30078187 missense probably benign 0.15
R6181:Tpo UTSW 12 30131885 missense probably benign 0.37
R6321:Tpo UTSW 12 30103108 missense probably damaging 1.00
R6433:Tpo UTSW 12 30084754 missense probably benign
R7206:Tpo UTSW 12 30103134 missense possibly damaging 0.76
R7234:Tpo UTSW 12 30092686 missense probably benign 0.00
R7473:Tpo UTSW 12 30092590 missense probably benign 0.15
R7571:Tpo UTSW 12 30119432 missense probably benign 0.00
R7709:Tpo UTSW 12 30131860 missense possibly damaging 0.62
R7844:Tpo UTSW 12 30100405 missense probably damaging 1.00
R7859:Tpo UTSW 12 30100574 missense probably damaging 1.00
R7883:Tpo UTSW 12 30103170 missense probably damaging 1.00
R8138:Tpo UTSW 12 30074104 missense probably benign 0.00
R8171:Tpo UTSW 12 30104046 missense probably damaging 1.00
R8726:Tpo UTSW 12 30055138 missense possibly damaging 0.95
R8877:Tpo UTSW 12 30092739 missense probably damaging 0.99
R9400:Tpo UTSW 12 30119442 missense possibly damaging 0.94
R9649:Tpo UTSW 12 30075876 missense probably damaging 1.00
X0050:Tpo UTSW 12 30078094 missense probably damaging 1.00
Z1088:Tpo UTSW 12 30094782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTCTCGGCTCTGATTC -3'
(R):5'- ACATGCCTTCTCCTGTGTAGG -3'

Sequencing Primer
(F):5'- GGGTGCTACCATTCTATACGAG -3'
(R):5'- AGGTTTTGGTGGGAGAACAC -3'
Posted On 2016-07-22