Incidental Mutation 'R5223:Zfp738'
ID 402452
Institutional Source Beutler Lab
Gene Symbol Zfp738
Ensembl Gene ENSMUSG00000048280
Gene Name zinc finger protein 738
Synonyms 6720487G11Rik, 3830402I07Rik
MMRRC Submission 042796-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R5223 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 67658685-67687071 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 67673063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 55 (T55K)
Ref Sequence ENSEMBL: ENSMUSP00000135050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110973] [ENSMUST00000125495] [ENSMUST00000137496] [ENSMUST00000175678] [ENSMUST00000175821]
AlphaFold B8JJX8
Predicted Effect probably damaging
Transcript: ENSMUST00000110973
AA Change: T52K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106600
Gene: ENSMUSG00000048280
AA Change: T52K

DomainStartEndE-ValueType
KRAB 2 62 1.97e-31 SMART
SCOP:d1fgja_ 76 119 1e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125495
AA Change: T55K

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135683
Gene: ENSMUSG00000048280
AA Change: T55K

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137496
AA Change: T65K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121275
Gene: ENSMUSG00000048280
AA Change: T65K

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
ZnF_C2H2 91 111 3.13e1 SMART
ZnF_C2H2 119 141 9.56e1 SMART
ZnF_C2H2 147 169 3.58e-2 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 8.34e-3 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
ZnF_C2H2 343 365 8.34e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 427 449 9.58e-3 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
ZnF_C2H2 567 589 5.42e-2 SMART
ZnF_C2H2 595 617 7.78e-3 SMART
ZnF_C2H2 623 645 2.05e-2 SMART
ZnF_C2H2 651 673 2.57e-3 SMART
ZnF_C2H2 679 701 7.26e-3 SMART
ZnF_C2H2 735 757 5.42e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175678
AA Change: T65K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134865
Gene: ENSMUSG00000048280
AA Change: T65K

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175821
AA Change: T55K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135050
Gene: ENSMUSG00000048280
AA Change: T55K

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
ZnF_C2H2 81 101 3.13e1 SMART
ZnF_C2H2 109 131 9.56e1 SMART
ZnF_C2H2 137 159 3.58e-2 SMART
ZnF_C2H2 165 187 3.21e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Gpnmb C T 6: 49,056,205 T539M probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Nhsl1 T A 10: 18,526,326 V1100E probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pacs1 C T 19: 5,145,141 V472I probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbbp8 C A 18: 11,721,690 A324E probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Slc4a10 G A 2: 62,253,366 G388S probably damaging Het
Smtn G T 11: 3,529,530 N512K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Tpo T A 12: 30,092,590 I712F probably damaging Het
Trim62 T C 4: 128,909,411 V418A probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Zfp738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zfp738 APN 13 67683401 critical splice donor site probably null
IGL01734:Zfp738 APN 13 67683444 utr 5 prime probably benign
IGL01980:Zfp738 APN 13 67669977 missense possibly damaging 0.80
IGL02052:Zfp738 APN 13 67671481 missense possibly damaging 0.87
IGL02330:Zfp738 APN 13 67671431 missense probably damaging 0.99
IGL02686:Zfp738 APN 13 67673652 missense probably damaging 1.00
I2505:Zfp738 UTSW 13 67673067 missense probably benign 0.36
R0219:Zfp738 UTSW 13 67683389 intron probably benign
R0491:Zfp738 UTSW 13 67670021 missense possibly damaging 0.87
R0722:Zfp738 UTSW 13 67671524 missense probably benign 0.09
R1116:Zfp738 UTSW 13 67670243 splice site probably null
R1425:Zfp738 UTSW 13 67670775 missense possibly damaging 0.77
R1854:Zfp738 UTSW 13 67670357 missense probably damaging 1.00
R2095:Zfp738 UTSW 13 67671303 missense probably damaging 1.00
R2171:Zfp738 UTSW 13 67670977 nonsense probably null
R2180:Zfp738 UTSW 13 67671194 missense probably damaging 1.00
R2225:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2226:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2907:Zfp738 UTSW 13 67670112 missense probably benign 0.33
R3605:Zfp738 UTSW 13 67671389 nonsense probably null
R4731:Zfp738 UTSW 13 67669914 missense probably damaging 1.00
R5037:Zfp738 UTSW 13 67670201 missense probably damaging 1.00
R5259:Zfp738 UTSW 13 67669686 missense probably benign
R5358:Zfp738 UTSW 13 67671012 missense probably damaging 0.98
R6404:Zfp738 UTSW 13 67671060 missense possibly damaging 0.89
R6874:Zfp738 UTSW 13 67670263 missense possibly damaging 0.93
R7041:Zfp738 UTSW 13 67670301 missense probably damaging 1.00
R7172:Zfp738 UTSW 13 67670408 missense probably damaging 1.00
R7178:Zfp738 UTSW 13 67673028 missense probably damaging 1.00
R7308:Zfp738 UTSW 13 67669553 missense probably benign 0.00
R7386:Zfp738 UTSW 13 67670250 missense probably damaging 1.00
R7453:Zfp738 UTSW 13 67670355 missense probably benign 0.42
R7456:Zfp738 UTSW 13 67669500 missense probably damaging 1.00
R7467:Zfp738 UTSW 13 67672961 missense probably benign 0.03
R7615:Zfp738 UTSW 13 67670203 missense probably damaging 0.96
R7663:Zfp738 UTSW 13 67683401 critical splice donor site probably null
R7752:Zfp738 UTSW 13 67672991 nonsense probably null
R7901:Zfp738 UTSW 13 67672991 nonsense probably null
R8042:Zfp738 UTSW 13 67670891 missense probably damaging 0.98
R8288:Zfp738 UTSW 13 67670789 missense possibly damaging 0.88
R8340:Zfp738 UTSW 13 67671112 missense probably damaging 0.98
R8735:Zfp738 UTSW 13 67671431 missense probably damaging 0.99
R8846:Zfp738 UTSW 13 67670036 missense probably benign 0.00
R8896:Zfp738 UTSW 13 67669791 missense
R9124:Zfp738 UTSW 13 67671338 missense possibly damaging 0.94
R9233:Zfp738 UTSW 13 67670898 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGAACACAAGTTAATATCATGGTGG -3'
(R):5'- TGGTGTGCCCATCAGAAAAC -3'

Sequencing Primer
(F):5'- CAAAGCTTATGAGATTCAAAGCATCC -3'
(R):5'- TGGTGTGCCCATCAGAAAACATATG -3'
Posted On 2016-07-22