Incidental Mutation 'R5223:Acin1'
ID 402455
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Name apoptotic chromatin condensation inducer 1
Synonyms 2610036I19Rik, 2610510L13Rik, Acinus
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R5223 (G1)
Quality Score 217
Status Not validated
Chromosome 14
Chromosomal Location 54879618-54924388 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CCGC to CC at 54880398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000022794] [ENSMUST00000067784] [ENSMUST00000111484] [ENSMUST00000123875] [ENSMUST00000126166] [ENSMUST00000141453] [ENSMUST00000148754] [ENSMUST00000150371] [ENSMUST00000167015] [ENSMUST00000169818]
AlphaFold Q9JIX8
Predicted Effect probably null
Transcript: ENSMUST00000022793
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022794
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067784
SMART Domains Protein: ENSMUSP00000066005
Gene: ENSMUSG00000059674

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 148 7.85e-18 SMART
CA 172 257 3.23e-28 SMART
CA 281 369 4.24e-14 SMART
CA 396 477 1.48e-22 SMART
Blast:CA 500 581 3e-31 BLAST
transmembrane domain 602 624 N/A INTRINSIC
Pfam:Cadherin_C 627 775 2e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111484
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123875
SMART Domains Protein: ENSMUSP00000117210
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125767
Predicted Effect probably null
Transcript: ENSMUST00000126166
SMART Domains Protein: ENSMUSP00000114546
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
RRM 239 308 8.3e-2 SMART
low complexity region 340 390 N/A INTRINSIC
low complexity region 397 435 N/A INTRINSIC
PDB:4A8X|B 436 460 4e-6 PDB
low complexity region 462 497 N/A INTRINSIC
low complexity region 502 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152773
Predicted Effect probably null
Transcript: ENSMUST00000141453
SMART Domains Protein: ENSMUSP00000116664
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
RRM 226 295 8.3e-2 SMART
low complexity region 327 377 N/A INTRINSIC
low complexity region 384 422 N/A INTRINSIC
PDB:4A8X|B 423 447 4e-6 PDB
low complexity region 449 484 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147714
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148754
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150371
SMART Domains Protein: ENSMUSP00000118069
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 223 248 N/A INTRINSIC
RRM 308 377 8.3e-2 SMART
low complexity region 409 459 N/A INTRINSIC
low complexity region 466 504 N/A INTRINSIC
PDB:4A8X|B 505 529 3e-6 PDB
low complexity region 531 566 N/A INTRINSIC
low complexity region 571 625 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167015
SMART Domains Protein: ENSMUSP00000125776
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167495
Predicted Effect probably benign
Transcript: ENSMUST00000169818
SMART Domains Protein: ENSMUSP00000131860
Gene: ENSMUSG00000091306

DomainStartEndE-ValueType
low complexity region 1 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138321
SMART Domains Protein: ENSMUSP00000119326
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
Pfam:RSB_motif 20 128 4.7e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,904,278 (GRCm39) V273M possibly damaging Het
Acvr1b T A 15: 101,091,857 (GRCm39) C46S probably damaging Het
Ahi1 A T 10: 20,846,818 (GRCm39) H416L possibly damaging Het
Aspm T A 1: 139,406,072 (GRCm39) L1653Q probably damaging Het
Cacna1a G A 8: 85,313,824 (GRCm39) V1533M possibly damaging Het
Ccdc33 C T 9: 57,940,267 (GRCm39) E502K possibly damaging Het
Ctnnd1 C T 2: 84,447,133 (GRCm39) V371M probably damaging Het
Cyp2a12 A T 7: 26,735,888 (GRCm39) probably null Het
Dnai4 T A 4: 102,906,600 (GRCm39) S738C possibly damaging Het
Ep400 A G 5: 110,816,496 (GRCm39) V2675A probably damaging Het
Foxh1 T A 15: 76,552,929 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gpnmb C T 6: 49,033,139 (GRCm39) T539M probably benign Het
Hdac1-ps A G 17: 78,799,867 (GRCm39) E286G probably benign Het
Hspa9 A G 18: 35,085,724 (GRCm39) probably null Het
Hspg2 T C 4: 137,271,225 (GRCm39) L2454P probably damaging Het
Ift140 T A 17: 25,254,786 (GRCm39) I422N probably benign Het
Igkv6-32 T C 6: 70,051,207 (GRCm39) S50G probably benign Het
Il23r T A 6: 67,463,154 (GRCm39) Y113F probably benign Het
Kcnt1 A G 2: 25,793,434 (GRCm39) D636G probably benign Het
Klhl41 G A 2: 69,510,171 (GRCm39) W569* probably null Het
Klra4 T A 6: 130,039,110 (GRCm39) D94V probably damaging Het
Lca5 T A 9: 83,280,666 (GRCm39) H378L probably benign Het
Lhx8 T A 3: 154,027,281 (GRCm39) T254S probably damaging Het
Lrch3 C T 16: 32,734,767 (GRCm39) R86W probably damaging Het
Lrp2 T A 2: 69,354,397 (GRCm39) N477I probably damaging Het
Man2a1 T A 17: 65,019,266 (GRCm39) I710K probably benign Het
Ncor1 A T 11: 62,229,826 (GRCm39) Y881N probably damaging Het
Nhsl1 T A 10: 18,402,074 (GRCm39) V1100E probably damaging Het
Oprk1 T C 1: 5,659,519 (GRCm39) V83A probably benign Het
Or4p8 T C 2: 88,727,678 (GRCm39) T88A probably benign Het
Or5p62 A G 7: 107,771,915 (GRCm39) V12A probably benign Het
Or7g35 T C 9: 19,496,322 (GRCm39) V163A probably benign Het
Pacs1 C T 19: 5,195,169 (GRCm39) V472I probably benign Het
Pard3b T C 1: 62,383,272 (GRCm39) Y789H probably damaging Het
Pcdha2 T C 18: 37,073,844 (GRCm39) Y492H probably damaging Het
Pcnt T C 10: 76,216,106 (GRCm39) N2261D probably damaging Het
Pex5l A T 3: 33,012,945 (GRCm39) S15T probably damaging Het
Plekhg4 A G 8: 106,105,581 (GRCm39) N682S probably benign Het
Poc5 A T 13: 96,539,463 (GRCm39) M335L probably benign Het
Polr1a C T 6: 71,944,891 (GRCm39) R1316W possibly damaging Het
Pp2d1 T C 17: 53,814,873 (GRCm39) H617R probably benign Het
Pramel24 T A 4: 143,454,591 (GRCm39) S296R probably benign Het
Prpsap1 T C 11: 116,378,974 (GRCm39) K65E probably benign Het
Ptgfrn T C 3: 100,952,909 (GRCm39) E775G probably benign Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Rbbp8 C A 18: 11,854,747 (GRCm39) A324E probably benign Het
Rfx6 G T 10: 51,554,092 (GRCm39) G63* probably null Het
Rpl37a T C 1: 72,751,308 (GRCm39) M47T probably benign Het
Samm50 T G 15: 84,084,831 (GRCm39) N187K probably benign Het
Skic2 A G 17: 35,064,142 (GRCm39) probably null Het
Slamf9 T C 1: 172,303,799 (GRCm39) I48T possibly damaging Het
Slc2a12 A G 10: 22,577,931 (GRCm39) K576E probably damaging Het
Slc4a10 G A 2: 62,083,710 (GRCm39) G388S probably damaging Het
Smtn G T 11: 3,479,530 (GRCm39) N512K probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sspo A G 6: 48,455,258 (GRCm39) Y3040C probably damaging Het
Stat1 T A 1: 52,183,401 (GRCm39) V389E probably damaging Het
Sult5a1 A T 8: 123,872,161 (GRCm39) M227K probably damaging Het
Thsd4 T C 9: 59,964,325 (GRCm39) D389G probably damaging Het
Tnxb T C 17: 34,923,052 (GRCm39) V2545A possibly damaging Het
Tpo T A 12: 30,142,589 (GRCm39) I712F probably damaging Het
Trim62 T C 4: 128,803,204 (GRCm39) V418A probably damaging Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r66 T C 7: 84,657,093 (GRCm39) D104G probably benign Het
Wdr26 T C 1: 181,015,251 (GRCm39) I371V probably benign Het
Zfp273 T G 13: 67,974,298 (GRCm39) C475W probably damaging Het
Zfp738 G T 13: 67,821,182 (GRCm39) T55K probably damaging Het
Zmym2 A G 14: 57,183,971 (GRCm39) I978V probably benign Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54,884,257 (GRCm39) missense probably damaging 1.00
IGL01530:Acin1 APN 14 54,881,443 (GRCm39) missense probably damaging 1.00
IGL02396:Acin1 APN 14 54,882,256 (GRCm39) intron probably benign
IGL02967:Acin1 APN 14 54,880,210 (GRCm39) missense possibly damaging 0.80
Protuberant UTSW 14 54,882,740 (GRCm39) missense probably damaging 1.00
R0411:Acin1 UTSW 14 54,884,231 (GRCm39) missense probably damaging 1.00
R0723:Acin1 UTSW 14 54,902,908 (GRCm39) missense probably damaging 0.98
R0755:Acin1 UTSW 14 54,889,292 (GRCm39) start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54,890,985 (GRCm39) unclassified probably benign
R1600:Acin1 UTSW 14 54,881,174 (GRCm39) intron probably benign
R1682:Acin1 UTSW 14 54,901,175 (GRCm39) missense probably damaging 1.00
R1721:Acin1 UTSW 14 54,901,995 (GRCm39) missense probably benign 0.01
R1756:Acin1 UTSW 14 54,902,661 (GRCm39) missense probably benign 0.30
R1867:Acin1 UTSW 14 54,881,718 (GRCm39) missense probably damaging 1.00
R1997:Acin1 UTSW 14 54,884,156 (GRCm39) splice site probably null
R2067:Acin1 UTSW 14 54,902,711 (GRCm39) missense probably damaging 1.00
R3947:Acin1 UTSW 14 54,916,790 (GRCm39) missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54,891,351 (GRCm39) unclassified probably benign
R4476:Acin1 UTSW 14 54,882,787 (GRCm39) missense probably damaging 1.00
R4501:Acin1 UTSW 14 54,924,044 (GRCm39) missense probably damaging 1.00
R4547:Acin1 UTSW 14 54,883,124 (GRCm39) missense probably benign 0.01
R4621:Acin1 UTSW 14 54,890,900 (GRCm39) unclassified probably benign
R4657:Acin1 UTSW 14 54,880,504 (GRCm39) missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54,924,215 (GRCm39) missense probably benign 0.00
R4696:Acin1 UTSW 14 54,880,474 (GRCm39) intron probably benign
R4806:Acin1 UTSW 14 54,916,685 (GRCm39) splice site probably benign
R4826:Acin1 UTSW 14 54,902,074 (GRCm39) missense probably damaging 0.97
R5096:Acin1 UTSW 14 54,916,679 (GRCm39) intron probably benign
R5153:Acin1 UTSW 14 54,883,070 (GRCm39) missense probably benign 0.25
R5260:Acin1 UTSW 14 54,880,279 (GRCm39) intron probably benign
R5525:Acin1 UTSW 14 54,901,848 (GRCm39) missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54,916,195 (GRCm39) splice site probably null
R5902:Acin1 UTSW 14 54,901,130 (GRCm39) missense probably benign 0.01
R6211:Acin1 UTSW 14 54,881,503 (GRCm39) missense probably damaging 1.00
R6524:Acin1 UTSW 14 54,882,740 (GRCm39) missense probably damaging 1.00
R6560:Acin1 UTSW 14 54,916,290 (GRCm39) missense probably benign 0.24
R6916:Acin1 UTSW 14 54,902,873 (GRCm39) missense probably benign 0.27
R7201:Acin1 UTSW 14 54,902,356 (GRCm39) missense possibly damaging 0.83
R7833:Acin1 UTSW 14 54,902,059 (GRCm39) missense possibly damaging 0.83
R8096:Acin1 UTSW 14 54,882,726 (GRCm39) missense possibly damaging 0.80
R8167:Acin1 UTSW 14 54,902,337 (GRCm39) missense probably benign 0.01
R8421:Acin1 UTSW 14 54,880,486 (GRCm39) missense unknown
R8771:Acin1 UTSW 14 54,880,496 (GRCm39) missense unknown
R8862:Acin1 UTSW 14 54,901,172 (GRCm39) missense probably benign 0.00
R9645:Acin1 UTSW 14 54,901,913 (GRCm39) missense probably benign 0.16
R9755:Acin1 UTSW 14 54,889,292 (GRCm39) missense probably damaging 0.99
X0021:Acin1 UTSW 14 54,904,558 (GRCm39) missense probably damaging 1.00
Z1177:Acin1 UTSW 14 54,880,207 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TACAGGTGTGCTTCGACTCC -3'
(R):5'- CTGTTAATAGAAACTGACAGTGACCC -3'

Sequencing Primer
(F):5'- GACTCCGGCTTCTGCTGTG -3'
(R):5'- AAGCACAGCCTGGGATCAGTTC -3'
Posted On 2016-07-22