Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Sntb1'

402458

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

042796-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 55642795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 461 (G461R)

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769]

AlphaFold

Q99L88

Predicted Effect

probably damaging
Transcript: ENSMUST00000039769
AA Change: G461R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: G461R

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Meta Mutation Damage Score

0.7492

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37
R9280:Sntb1	UTSW	15	55906375	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAAGTAGTCAGGCCGCCTAC -3'
(R):5'- TAAGAAATTCGTGGCTGGGCAC -3'

Sequencing Primer
(F):5'- ACTTCCAAGTCATTGCACATG -3'
(R):5'- CTGGGCACTGGGTTGAAG -3'

Posted On

2016-07-22