Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Foxh1'

402459

Institutional Source

Beutler Lab

Gene Symbol

Foxh1

Ensembl Gene

ENSMUSG00000033837

Gene Name

forkhead box H1

Synonyms

Fast2

MMRRC Submission

042796-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76668225-76669948 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 76668729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155515 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004294] [ENSMUST00000037551] [ENSMUST00000037824] [ENSMUST00000135388] [ENSMUST00000230451] [ENSMUST00000230964]

AlphaFold

O88621

Predicted Effect

probably benign
Transcript: ENSMUST00000004294

SMART Domains

Protein: ENSMUSP00000004294
Gene: ENSMUSG00000004187

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	36	45	N/A	INTRINSIC
low complexity region	117	129	N/A	INTRINSIC
low complexity region	179	192	N/A	INTRINSIC
coiled coil region	195	235	N/A	INTRINSIC
coiled coil region	274	345	N/A	INTRINSIC
KISc	407	740	3.21e-141	SMART
low complexity region	745	781	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000037551

SMART Domains

Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

Domain	Start	End	E-Value	Type
ANK	70	99	2.5e3	SMART
ANK	103	132	3.41e-3	SMART
ANK	136	165	2.66e-5	SMART
ANK	231	260	2.58e-3	SMART
ANK	264	293	4.03e-5	SMART
low complexity region	323	346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000037824
AA Change: I262L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036591
Gene: ENSMUSG00000033837
AA Change: I262L

Domain	Start	End	E-Value	Type
FH	62	152	2.71e-34	SMART
low complexity region	183	194	N/A	INTRINSIC
low complexity region	331	345	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000135388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229513

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230207

Predicted Effect

probably benign
Transcript: ENSMUST00000230451

Predicted Effect

probably benign
Transcript: ENSMUST00000230964

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FOXH1 encodes a human homolog of Xenopus forkhead activin signal transducer-1. FOXH1 protein binds SMAD2 and activates an activin response element via binding the DNA motif TGT(G/T)(T/G)ATT. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional knockout of this gene in the lateral plate mesoderm results in death within a few days after birth. Mutant animals exhibit right isomerism affecting the heart, lungs, and stomach. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Foxh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02041:Foxh1	APN	15	76668920	missense	probably damaging	1.00
R0112:Foxh1	UTSW	15	76669010	missense	probably benign	0.00
R0126:Foxh1	UTSW	15	76669254	missense	probably damaging	1.00
R2266:Foxh1	UTSW	15	76668620	missense	probably benign	0.00
R5775:Foxh1	UTSW	15	76669849	missense	probably benign	0.44
R6666:Foxh1	UTSW	15	76668413	missense	probably damaging	1.00
R7528:Foxh1	UTSW	15	76669311	missense	probably benign	0.03
R8095:Foxh1	UTSW	15	76669008	nonsense	probably null
R8936:Foxh1	UTSW	15	76668519	unclassified	probably benign
R9287:Foxh1	UTSW	15	76668926	missense	probably damaging	0.99
R9429:Foxh1	UTSW	15	76669242	missense	probably null	0.16
R9647:Foxh1	UTSW	15	76669260	missense	possibly damaging	0.76
Z1177:Foxh1	UTSW	15	76669021	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTGCCTACGCTCCAGTAAG -3'
(R):5'- TTCAGCATCAAGTCCCTGC -3'

Sequencing Primer
(F):5'- CCAAGGGCATTACTACATTGGGC -3'
(R):5'- ACCCTGGGAAAGAATCCA -3'

Posted On

2016-07-22