Incidental Mutation 'R5223:Lrch3'
ID 402461
Institutional Source Beutler Lab
Gene Symbol Lrch3
Ensembl Gene ENSMUSG00000022801
Gene Name leucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms LOC385628, 2210409B11Rik
MMRRC Submission 042796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R5223 (G1)
Quality Score 141
Status Not validated
Chromosome 16
Chromosomal Location 32734470-32836017 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32734767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 86 (R86W)
Ref Sequence ENSEMBL: ENSMUSP00000130009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023491] [ENSMUST00000135193] [ENSMUST00000164486] [ENSMUST00000165616] [ENSMUST00000170201] [ENSMUST00000170899]
AlphaFold Q8BVU0
Predicted Effect probably damaging
Transcript: ENSMUST00000023491
AA Change: R86W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135193
AA Change: R86W

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156928
Predicted Effect probably damaging
Transcript: ENSMUST00000164486
AA Change: R86W

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131416
Gene: ENSMUSG00000022801
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165616
AA Change: R86W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170201
AA Change: R86W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170899
AA Change: R86W

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,904,278 (GRCm39) V273M possibly damaging Het
Acin1 CCGC CC 14: 54,880,398 (GRCm39) probably null Het
Acvr1b T A 15: 101,091,857 (GRCm39) C46S probably damaging Het
Ahi1 A T 10: 20,846,818 (GRCm39) H416L possibly damaging Het
Aspm T A 1: 139,406,072 (GRCm39) L1653Q probably damaging Het
Cacna1a G A 8: 85,313,824 (GRCm39) V1533M possibly damaging Het
Ccdc33 C T 9: 57,940,267 (GRCm39) E502K possibly damaging Het
Ctnnd1 C T 2: 84,447,133 (GRCm39) V371M probably damaging Het
Cyp2a12 A T 7: 26,735,888 (GRCm39) probably null Het
Dnai4 T A 4: 102,906,600 (GRCm39) S738C possibly damaging Het
Ep400 A G 5: 110,816,496 (GRCm39) V2675A probably damaging Het
Foxh1 T A 15: 76,552,929 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gpnmb C T 6: 49,033,139 (GRCm39) T539M probably benign Het
Hdac1-ps A G 17: 78,799,867 (GRCm39) E286G probably benign Het
Hspa9 A G 18: 35,085,724 (GRCm39) probably null Het
Hspg2 T C 4: 137,271,225 (GRCm39) L2454P probably damaging Het
Ift140 T A 17: 25,254,786 (GRCm39) I422N probably benign Het
Igkv6-32 T C 6: 70,051,207 (GRCm39) S50G probably benign Het
Il23r T A 6: 67,463,154 (GRCm39) Y113F probably benign Het
Kcnt1 A G 2: 25,793,434 (GRCm39) D636G probably benign Het
Klhl41 G A 2: 69,510,171 (GRCm39) W569* probably null Het
Klra4 T A 6: 130,039,110 (GRCm39) D94V probably damaging Het
Lca5 T A 9: 83,280,666 (GRCm39) H378L probably benign Het
Lhx8 T A 3: 154,027,281 (GRCm39) T254S probably damaging Het
Lrp2 T A 2: 69,354,397 (GRCm39) N477I probably damaging Het
Man2a1 T A 17: 65,019,266 (GRCm39) I710K probably benign Het
Ncor1 A T 11: 62,229,826 (GRCm39) Y881N probably damaging Het
Nhsl1 T A 10: 18,402,074 (GRCm39) V1100E probably damaging Het
Oprk1 T C 1: 5,659,519 (GRCm39) V83A probably benign Het
Or4p8 T C 2: 88,727,678 (GRCm39) T88A probably benign Het
Or5p62 A G 7: 107,771,915 (GRCm39) V12A probably benign Het
Or7g35 T C 9: 19,496,322 (GRCm39) V163A probably benign Het
Pacs1 C T 19: 5,195,169 (GRCm39) V472I probably benign Het
Pard3b T C 1: 62,383,272 (GRCm39) Y789H probably damaging Het
Pcdha2 T C 18: 37,073,844 (GRCm39) Y492H probably damaging Het
Pcnt T C 10: 76,216,106 (GRCm39) N2261D probably damaging Het
Pex5l A T 3: 33,012,945 (GRCm39) S15T probably damaging Het
Plekhg4 A G 8: 106,105,581 (GRCm39) N682S probably benign Het
Poc5 A T 13: 96,539,463 (GRCm39) M335L probably benign Het
Polr1a C T 6: 71,944,891 (GRCm39) R1316W possibly damaging Het
Pp2d1 T C 17: 53,814,873 (GRCm39) H617R probably benign Het
Pramel24 T A 4: 143,454,591 (GRCm39) S296R probably benign Het
Prpsap1 T C 11: 116,378,974 (GRCm39) K65E probably benign Het
Ptgfrn T C 3: 100,952,909 (GRCm39) E775G probably benign Het
Ptprc T A 1: 138,045,600 (GRCm39) I87F probably benign Het
Rbbp8 C A 18: 11,854,747 (GRCm39) A324E probably benign Het
Rfx6 G T 10: 51,554,092 (GRCm39) G63* probably null Het
Rpl37a T C 1: 72,751,308 (GRCm39) M47T probably benign Het
Samm50 T G 15: 84,084,831 (GRCm39) N187K probably benign Het
Skic2 A G 17: 35,064,142 (GRCm39) probably null Het
Slamf9 T C 1: 172,303,799 (GRCm39) I48T possibly damaging Het
Slc2a12 A G 10: 22,577,931 (GRCm39) K576E probably damaging Het
Slc4a10 G A 2: 62,083,710 (GRCm39) G388S probably damaging Het
Smtn G T 11: 3,479,530 (GRCm39) N512K probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Sspo A G 6: 48,455,258 (GRCm39) Y3040C probably damaging Het
Stat1 T A 1: 52,183,401 (GRCm39) V389E probably damaging Het
Sult5a1 A T 8: 123,872,161 (GRCm39) M227K probably damaging Het
Thsd4 T C 9: 59,964,325 (GRCm39) D389G probably damaging Het
Tnxb T C 17: 34,923,052 (GRCm39) V2545A possibly damaging Het
Tpo T A 12: 30,142,589 (GRCm39) I712F probably damaging Het
Trim62 T C 4: 128,803,204 (GRCm39) V418A probably damaging Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r66 T C 7: 84,657,093 (GRCm39) D104G probably benign Het
Wdr26 T C 1: 181,015,251 (GRCm39) I371V probably benign Het
Zfp273 T G 13: 67,974,298 (GRCm39) C475W probably damaging Het
Zfp738 G T 13: 67,821,182 (GRCm39) T55K probably damaging Het
Zmym2 A G 14: 57,183,971 (GRCm39) I978V probably benign Het
Other mutations in Lrch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lrch3 APN 16 32,815,335 (GRCm39) missense probably benign 0.10
IGL01400:Lrch3 APN 16 32,799,911 (GRCm39) missense probably damaging 1.00
IGL02565:Lrch3 APN 16 32,826,084 (GRCm39) missense probably benign 0.00
IGL03076:Lrch3 APN 16 32,802,223 (GRCm39) missense possibly damaging 0.52
IGL03103:Lrch3 APN 16 32,772,507 (GRCm39) missense probably damaging 1.00
IGL03125:Lrch3 APN 16 32,734,647 (GRCm39) missense possibly damaging 0.83
IGL03349:Lrch3 APN 16 32,775,694 (GRCm39) missense probably damaging 1.00
eluted UTSW 16 32,806,377 (GRCm39) missense probably null
leached UTSW 16 32,779,833 (GRCm39) missense probably damaging 1.00
R0054:Lrch3 UTSW 16 32,816,222 (GRCm39) intron probably benign
R0123:Lrch3 UTSW 16 32,782,124 (GRCm39) splice site probably benign
R0225:Lrch3 UTSW 16 32,782,124 (GRCm39) splice site probably benign
R0326:Lrch3 UTSW 16 32,799,870 (GRCm39) missense probably damaging 1.00
R0455:Lrch3 UTSW 16 32,807,250 (GRCm39) missense probably damaging 0.99
R0734:Lrch3 UTSW 16 32,817,853 (GRCm39) nonsense probably null
R1204:Lrch3 UTSW 16 32,829,584 (GRCm39) missense probably damaging 1.00
R1470:Lrch3 UTSW 16 32,808,865 (GRCm39) splice site probably benign
R1526:Lrch3 UTSW 16 32,770,746 (GRCm39) missense probably damaging 1.00
R1597:Lrch3 UTSW 16 32,770,781 (GRCm39) nonsense probably null
R1850:Lrch3 UTSW 16 32,807,163 (GRCm39) missense probably benign 0.01
R1966:Lrch3 UTSW 16 32,734,755 (GRCm39) missense possibly damaging 0.94
R2241:Lrch3 UTSW 16 32,816,211 (GRCm39) missense probably damaging 0.99
R2313:Lrch3 UTSW 16 32,782,045 (GRCm39) missense probably damaging 1.00
R2902:Lrch3 UTSW 16 32,770,766 (GRCm39) missense probably damaging 1.00
R4723:Lrch3 UTSW 16 32,808,854 (GRCm39) splice site probably null
R4795:Lrch3 UTSW 16 32,826,074 (GRCm39) missense probably damaging 1.00
R4970:Lrch3 UTSW 16 32,818,883 (GRCm39) missense probably damaging 1.00
R5292:Lrch3 UTSW 16 32,796,177 (GRCm39) missense probably damaging 1.00
R5414:Lrch3 UTSW 16 32,806,335 (GRCm39) splice site probably null
R5470:Lrch3 UTSW 16 32,818,960 (GRCm39) missense probably damaging 1.00
R5594:Lrch3 UTSW 16 32,734,554 (GRCm39) missense probably damaging 0.99
R5843:Lrch3 UTSW 16 32,818,896 (GRCm39) missense probably damaging 1.00
R5862:Lrch3 UTSW 16 32,816,179 (GRCm39) missense probably damaging 1.00
R5911:Lrch3 UTSW 16 32,779,833 (GRCm39) missense probably damaging 1.00
R5932:Lrch3 UTSW 16 32,796,106 (GRCm39) missense probably damaging 1.00
R6519:Lrch3 UTSW 16 32,815,367 (GRCm39) critical splice donor site probably benign
R6731:Lrch3 UTSW 16 32,770,790 (GRCm39) missense probably damaging 1.00
R7182:Lrch3 UTSW 16 32,814,149 (GRCm39) missense probably benign 0.05
R7197:Lrch3 UTSW 16 32,810,665 (GRCm39) missense probably damaging 1.00
R7319:Lrch3 UTSW 16 32,815,363 (GRCm39) missense probably benign 0.19
R7392:Lrch3 UTSW 16 32,807,125 (GRCm39) nonsense probably null
R7408:Lrch3 UTSW 16 32,807,113 (GRCm39) nonsense probably null
R7414:Lrch3 UTSW 16 32,818,883 (GRCm39) missense probably damaging 1.00
R7425:Lrch3 UTSW 16 32,826,077 (GRCm39) missense probably damaging 1.00
R7909:Lrch3 UTSW 16 32,829,663 (GRCm39) missense probably benign 0.00
R7956:Lrch3 UTSW 16 32,806,377 (GRCm39) missense probably null
R8009:Lrch3 UTSW 16 32,826,083 (GRCm39) missense possibly damaging 0.72
R8247:Lrch3 UTSW 16 32,829,713 (GRCm39) nonsense probably null
R8408:Lrch3 UTSW 16 32,775,750 (GRCm39) missense probably damaging 1.00
R8686:Lrch3 UTSW 16 32,802,223 (GRCm39) missense possibly damaging 0.52
R8756:Lrch3 UTSW 16 32,808,810 (GRCm39) missense probably benign 0.33
R8947:Lrch3 UTSW 16 32,802,199 (GRCm39) missense possibly damaging 0.66
R9459:Lrch3 UTSW 16 32,799,775 (GRCm39) missense probably damaging 0.99
R9710:Lrch3 UTSW 16 32,796,108 (GRCm39) nonsense probably null
Z1176:Lrch3 UTSW 16 32,734,686 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGGAAAACCTGCTTGTGGG -3'
(R):5'- TGCCGAGATTTCTGAGAGCG -3'

Sequencing Primer
(F):5'- AGTACTCTGGCCCTGTGG -3'
(R):5'- CCGAGATTTCTGAGAGCGATTCAAG -3'
Posted On 2016-07-22