Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Tnxb'

402463

Institutional Source

Beutler Lab

Gene Symbol

Tnxb

Ensembl Gene

ENSMUSG00000033327

Gene Name

tenascin XB

Synonyms

Tnx, TN-MHC

MMRRC Submission

042796-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34670535-34719815 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34704078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2545 (V2545A)

Ref Sequence

ENSEMBL: ENSMUSP00000084661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087399
AA Change: V2545A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: V2545A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
low complexity region	92	103	N/A	INTRINSIC
EGF	173	201	1.59e1	SMART
EGF	204	232	7.41e0	SMART
EGF	235	263	2.64e1	SMART
EGF	266	294	2.64e1	SMART
EGF	297	325	9.13e0	SMART
EGF	328	356	2.07e1	SMART
EGF_like	359	387	3.16e1	SMART
EGF_like	390	418	4.64e1	SMART
EGF_like	421	449	3.29e1	SMART
EGF_like	452	480	7.09e1	SMART
EGF	483	511	1.15e1	SMART
EGF	514	542	1.91e1	SMART
EGF_like	545	573	4.11e1	SMART
EGF	576	604	7.95e0	SMART
EGF	607	635	1.23e1	SMART
EGF_like	638	666	4.93e1	SMART
EGF_like	674	702	5.24e1	SMART
EGF	705	733	2.29e1	SMART
FN3	736	816	4.12e-3	SMART
FN3	827	904	1.21e-9	SMART
FN3	1047	1126	3.97e-5	SMART
FN3	1142	1223	3.62e-8	SMART
low complexity region	1230	1241	N/A	INTRINSIC
FN3	1242	1320	2.31e-6	SMART
FN3	1351	1431	8.77e-7	SMART
FN3	1460	1539	3.01e-5	SMART
FN3	1556	1636	2.76e-4	SMART
FN3	1657	1736	5.78e-7	SMART
FN3	1752	1832	4.7e-7	SMART
FN3	1851	1929	1.95e-4	SMART
FN3	1955	2034	4.56e-5	SMART
FN3	2066	2145	2.23e-8	SMART
FN3	2164	2244	7.75e-8	SMART
FN3	2279	2358	8.5e-5	SMART
FN3	2387	2467	2.94e-8	SMART
FN3	2501	2580	1.7e-4	SMART
low complexity region	2588	2598	N/A	INTRINSIC
FN3	2607	2687	6.75e-8	SMART
FN3	2716	2795	7.4e-5	SMART
FN3	2822	2902	1.35e-7	SMART
FN3	2931	3010	5.61e-5	SMART
FN3	3026	3106	6.01e-5	SMART
FN3	3120	3199	6.45e-5	SMART
FN3	3214	3293	9.54e-8	SMART
FN3	3316	3396	2.81e-5	SMART
FN3	3416	3502	1.98e-5	SMART
FN3	3518	3596	5.65e-10	SMART
FN3	3607	3682	7.63e-7	SMART
FN3	3695	3770	6.54e-6	SMART
FBG	3787	3997	8.88e-125	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168533

SMART Domains

Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
low complexity region	92	103	N/A	INTRINSIC
EGF	173	201	1.59e1	SMART
EGF	204	232	7.41e0	SMART
EGF	235	263	2.64e1	SMART
EGF	266	294	2.64e1	SMART
EGF	297	325	9.13e0	SMART
EGF	328	356	2.07e1	SMART
EGF_like	359	387	3.16e1	SMART
EGF_like	390	418	4.64e1	SMART
EGF_like	421	449	3.29e1	SMART
EGF_like	452	480	7.09e1	SMART
EGF	483	511	1.15e1	SMART
EGF	514	542	1.91e1	SMART
EGF_like	545	573	4.11e1	SMART
EGF	576	604	7.95e0	SMART
EGF	607	635	1.23e1	SMART
EGF_like	638	666	4.93e1	SMART
EGF_like	674	702	5.24e1	SMART
EGF	705	733	2.29e1	SMART
FN3	736	816	4.12e-3	SMART
FN3	827	904	1.21e-9	SMART
FN3	924	1003	3.97e-5	SMART
FN3	1019	1100	3.62e-8	SMART
low complexity region	1107	1118	N/A	INTRINSIC
FN3	1119	1197	2.31e-6	SMART
FN3	1228	1308	8.77e-7	SMART
FN3	1337	1416	3.01e-5	SMART
FN3	1433	1513	2.76e-4	SMART
FN3	1534	1613	5.78e-7	SMART
FN3	1629	1709	4.7e-7	SMART
FN3	1728	1806	1.95e-4	SMART
FN3	1832	1911	4.56e-5	SMART
FN3	1943	2022	2.23e-8	SMART
FN3	2051	2130	5.61e-5	SMART
FN3	2146	2226	6.01e-5	SMART
FN3	2240	2319	6.45e-5	SMART
FN3	2334	2413	9.54e-8	SMART
FN3	2436	2516	2.81e-5	SMART
FN3	2536	2622	1.98e-5	SMART
FN3	2638	2716	5.65e-10	SMART
FN3	2727	2802	7.63e-7	SMART
FN3	2815	2890	6.54e-6	SMART
FBG	2907	3117	8.88e-125	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Tnxb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Tnxb	APN	17	34685629	missense	probably damaging	1.00
IGL00424:Tnxb	APN	17	34714692	missense	probably damaging	1.00
IGL00486:Tnxb	APN	17	34692382	missense	probably damaging	1.00
IGL00952:Tnxb	APN	17	34713128	missense	probably damaging	1.00
IGL00974:Tnxb	APN	17	34718733	critical splice donor site	probably null
IGL01017:Tnxb	APN	17	34693808	missense	probably damaging	0.98
IGL01082:Tnxb	APN	17	34714610	missense	probably damaging	0.97
IGL01397:Tnxb	APN	17	34714673	missense	probably damaging	0.99
IGL01473:Tnxb	APN	17	34685701	missense	probably damaging	0.99
IGL01642:Tnxb	APN	17	34718514	missense	probably damaging	1.00
IGL01774:Tnxb	APN	17	34688839	missense	probably damaging	1.00
IGL01971:Tnxb	APN	17	34672297	missense	probably damaging	1.00
IGL02016:Tnxb	APN	17	34672275	missense	probably damaging	0.98
IGL02160:Tnxb	APN	17	34714745	missense	probably benign	0.01
IGL02473:Tnxb	APN	17	34717762	missense	probably damaging	1.00
IGL02666:Tnxb	APN	17	34684939	missense	probably benign	0.20
IGL02831:Tnxb	APN	17	34703571	missense	possibly damaging	0.93
IGL02838:Tnxb	APN	17	34689632	missense	possibly damaging	0.74
IGL02965:Tnxb	APN	17	34709654	missense	possibly damaging	0.93
IGL03155:Tnxb	APN	17	34713595	missense	probably damaging	1.00
IGL03194:Tnxb	APN	17	34695947	nonsense	probably null
IGL03215:Tnxb	APN	17	34692525	missense	possibly damaging	0.66
IGL03256:Tnxb	APN	17	34688720	missense	probably damaging	1.00
BB008:Tnxb	UTSW	17	34688698	missense	probably damaging	1.00
BB018:Tnxb	UTSW	17	34688698	missense	probably damaging	1.00
E0370:Tnxb	UTSW	17	34678943	missense	probably damaging	1.00
R0006:Tnxb	UTSW	17	34682292	missense	probably benign	0.07
R0049:Tnxb	UTSW	17	34709568	missense	possibly damaging	0.93
R0050:Tnxb	UTSW	17	34673325	missense	probably damaging	1.00
R0233:Tnxb	UTSW	17	34699033	missense	probably benign	0.32
R0233:Tnxb	UTSW	17	34699033	missense	probably benign	0.32
R0311:Tnxb	UTSW	17	34716984	missense	probably damaging	0.97
R0326:Tnxb	UTSW	17	34698179	missense	probably benign	0.32
R0387:Tnxb	UTSW	17	34683574	missense	probably benign	0.30
R0396:Tnxb	UTSW	17	34671733	missense	probably damaging	1.00
R0511:Tnxb	UTSW	17	34718245	missense	probably damaging	0.96
R0540:Tnxb	UTSW	17	34671918	missense	probably damaging	1.00
R0563:Tnxb	UTSW	17	34716947	missense	probably benign	0.05
R0575:Tnxb	UTSW	17	34717206	missense	possibly damaging	0.91
R0586:Tnxb	UTSW	17	34672144	missense	probably damaging	1.00
R0607:Tnxb	UTSW	17	34671918	missense	probably damaging	1.00
R0622:Tnxb	UTSW	17	34718729	missense	probably damaging	1.00
R0624:Tnxb	UTSW	17	34683548	missense	probably damaging	1.00
R0709:Tnxb	UTSW	17	34689354	missense	probably damaging	1.00
R0898:Tnxb	UTSW	17	34670745	missense	probably damaging	1.00
R0970:Tnxb	UTSW	17	34698943	missense	possibly damaging	0.85
R0972:Tnxb	UTSW	17	34685143	missense	probably damaging	1.00
R1118:Tnxb	UTSW	17	34685043	missense	probably damaging	1.00
R1119:Tnxb	UTSW	17	34685043	missense	probably damaging	1.00
R1226:Tnxb	UTSW	17	34688929	missense	probably damaging	1.00
R1296:Tnxb	UTSW	17	34671577	missense	probably damaging	1.00
R1297:Tnxb	UTSW	17	34710166	missense	probably damaging	0.96
R1349:Tnxb	UTSW	17	34710293	missense	possibly damaging	0.67
R1356:Tnxb	UTSW	17	34695472	missense	possibly damaging	0.53
R1372:Tnxb	UTSW	17	34710293	missense	possibly damaging	0.67
R1521:Tnxb	UTSW	17	34711503	missense	probably damaging	1.00
R1522:Tnxb	UTSW	17	34718638	missense	probably damaging	1.00
R1532:Tnxb	UTSW	17	34710830	missense	probably damaging	1.00
R1735:Tnxb	UTSW	17	34717970	missense	probably damaging	1.00
R1778:Tnxb	UTSW	17	34683574	missense	probably benign	0.30
R1802:Tnxb	UTSW	17	34703889	missense	probably damaging	0.98
R1824:Tnxb	UTSW	17	34692333	nonsense	probably null
R1838:Tnxb	UTSW	17	34678910	missense	probably damaging	0.96
R1863:Tnxb	UTSW	17	34670874	missense	probably damaging	1.00
R1865:Tnxb	UTSW	17	34703457	nonsense	probably null
R1867:Tnxb	UTSW	17	34671847	missense	probably damaging	1.00
R1883:Tnxb	UTSW	17	34689565	missense	probably benign	0.01
R1884:Tnxb	UTSW	17	34689565	missense	probably benign	0.01
R1889:Tnxb	UTSW	17	34695825	missense	probably damaging	0.97
R1969:Tnxb	UTSW	17	34679081	missense	probably benign	0.20
R1989:Tnxb	UTSW	17	34683377	missense	probably benign	0.08
R1989:Tnxb	UTSW	17	34693885	missense	probably damaging	1.00
R1991:Tnxb	UTSW	17	34671904	missense	probably damaging	1.00
R1991:Tnxb	UTSW	17	34682251	missense	probably damaging	1.00
R1992:Tnxb	UTSW	17	34671904	missense	probably damaging	1.00
R2001:Tnxb	UTSW	17	34692579	missense	possibly damaging	0.82
R2018:Tnxb	UTSW	17	34671750	missense	probably benign	0.04
R2030:Tnxb	UTSW	17	34718469	missense	probably damaging	1.00
R2037:Tnxb	UTSW	17	34699205	missense	probably damaging	1.00
R2103:Tnxb	UTSW	17	34682251	missense	probably damaging	1.00
R2116:Tnxb	UTSW	17	34672227	missense	probably damaging	1.00
R2206:Tnxb	UTSW	17	34709417	missense	possibly damaging	0.86
R2207:Tnxb	UTSW	17	34709417	missense	possibly damaging	0.86
R2215:Tnxb	UTSW	17	34704140	missense	possibly damaging	0.93
R2413:Tnxb	UTSW	17	34718278	missense	probably damaging	0.99
R2680:Tnxb	UTSW	17	34703620	missense	possibly damaging	0.51
R2910:Tnxb	UTSW	17	34672450	missense	probably damaging	1.00
R2984:Tnxb	UTSW	17	34678662	nonsense	probably null
R3120:Tnxb	UTSW	17	34692355	missense	possibly damaging	0.86
R3429:Tnxb	UTSW	17	34672631	nonsense	probably null
R3429:Tnxb	UTSW	17	34703587	missense	probably damaging	0.98
R3552:Tnxb	UTSW	17	34718721	missense	probably damaging	1.00
R3698:Tnxb	UTSW	17	34690433	critical splice donor site	probably null
R3720:Tnxb	UTSW	17	34712964	missense	possibly damaging	0.95
R3841:Tnxb	UTSW	17	34698923	missense	possibly damaging	0.72
R3848:Tnxb	UTSW	17	34690395	missense	possibly damaging	0.82
R3886:Tnxb	UTSW	17	34718911	missense	probably damaging	1.00
R4074:Tnxb	UTSW	17	34671871	missense	probably benign	0.22
R4159:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4160:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4161:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4181:Tnxb	UTSW	17	34709454	missense	possibly damaging	0.93
R4210:Tnxb	UTSW	17	34710977	missense	possibly damaging	0.84
R4275:Tnxb	UTSW	17	34698231	missense	probably damaging	0.98
R4329:Tnxb	UTSW	17	34693864	missense	probably damaging	1.00
R4394:Tnxb	UTSW	17	34678662	nonsense	probably null
R4395:Tnxb	UTSW	17	34678662	nonsense	probably null
R4397:Tnxb	UTSW	17	34678662	nonsense	probably null
R4540:Tnxb	UTSW	17	34703335	missense	possibly damaging	0.86
R4673:Tnxb	UTSW	17	34672540	missense	probably damaging	0.99
R4719:Tnxb	UTSW	17	34689420	missense	probably damaging	1.00
R4725:Tnxb	UTSW	17	34699067	missense	probably damaging	0.99
R4753:Tnxb	UTSW	17	34695935	missense	possibly damaging	0.71
R4777:Tnxb	UTSW	17	34671943	missense	probably damaging	1.00
R4837:Tnxb	UTSW	17	34718007	missense	probably damaging	0.98
R4898:Tnxb	UTSW	17	34695592	missense	possibly damaging	0.95
R4938:Tnxb	UTSW	17	34713632	missense	probably damaging	1.00
R5044:Tnxb	UTSW	17	34717483	missense	probably damaging	1.00
R5100:Tnxb	UTSW	17	34710928	missense	probably damaging	0.99
R5269:Tnxb	UTSW	17	34703608	missense	possibly damaging	0.95
R5333:Tnxb	UTSW	17	34690231	missense	probably damaging	1.00
R5454:Tnxb	UTSW	17	34709625	missense	possibly damaging	0.71
R5470:Tnxb	UTSW	17	34716973	missense	probably null	1.00
R5475:Tnxb	UTSW	17	34689593	missense	probably damaging	1.00
R5574:Tnxb	UTSW	17	34711024	missense	probably benign
R5596:Tnxb	UTSW	17	34688804	missense	probably damaging	1.00
R5599:Tnxb	UTSW	17	34690202	missense	probably damaging	1.00
R5599:Tnxb	UTSW	17	34690205	missense	probably benign	0.22
R5615:Tnxb	UTSW	17	34683418	missense	probably damaging	1.00
R5620:Tnxb	UTSW	17	34717530	nonsense	probably null
R5625:Tnxb	UTSW	17	34685211	missense	probably benign	0.30
R5734:Tnxb	UTSW	17	34698910	missense	possibly damaging	0.53
R5896:Tnxb	UTSW	17	34672152	missense	probably damaging	1.00
R5961:Tnxb	UTSW	17	34718635	missense	probably damaging	1.00
R5974:Tnxb	UTSW	17	34685707	missense	probably damaging	1.00
R6091:Tnxb	UTSW	17	34710364	missense	probably damaging	0.98
R6134:Tnxb	UTSW	17	34672012	missense	probably damaging	0.96
R6325:Tnxb	UTSW	17	34692424	missense	probably damaging	1.00
R6358:Tnxb	UTSW	17	34678994	missense	probably damaging	0.98
R6362:Tnxb	UTSW	17	34694388	missense	probably damaging	1.00
R6432:Tnxb	UTSW	17	34717917	missense	probably damaging	1.00
R6461:Tnxb	UTSW	17	34671898	missense	probably damaging	1.00
R6467:Tnxb	UTSW	17	34693924	missense	probably damaging	1.00
R6476:Tnxb	UTSW	17	34690192	missense	probably damaging	0.98
R6477:Tnxb	UTSW	17	34719539	missense	probably damaging	1.00
R6631:Tnxb	UTSW	17	34718248	missense	probably damaging	1.00
R6774:Tnxb	UTSW	17	34709632	nonsense	probably null
R6787:Tnxb	UTSW	17	34710736	missense	probably benign	0.02
R6805:Tnxb	UTSW	17	34698153	missense	possibly damaging	0.93
R6860:Tnxb	UTSW	17	34713157	missense	probably damaging	0.99
R6883:Tnxb	UTSW	17	34718519	missense	probably damaging	1.00
R7049:Tnxb	UTSW	17	34717268	critical splice donor site	probably null
R7107:Tnxb	UTSW	17	34671340	missense	unknown
R7172:Tnxb	UTSW	17	34696020	missense	probably damaging	1.00
R7206:Tnxb	UTSW	17	34704101	missense	possibly damaging	0.71
R7219:Tnxb	UTSW	17	34679065	missense	probably benign	0.08
R7237:Tnxb	UTSW	17	34682196	missense	possibly damaging	0.82
R7257:Tnxb	UTSW	17	34716501	missense	probably benign	0.44
R7269:Tnxb	UTSW	17	34695454	missense	probably damaging	1.00
R7302:Tnxb	UTSW	17	34678901	missense	probably benign	0.41
R7372:Tnxb	UTSW	17	34717254	missense	possibly damaging	0.72
R7384:Tnxb	UTSW	17	34718518	missense	probably damaging	1.00
R7447:Tnxb	UTSW	17	34718470	missense	probably damaging	1.00
R7449:Tnxb	UTSW	17	34703361	missense	possibly damaging	0.93
R7480:Tnxb	UTSW	17	34715773	missense	probably damaging	0.96
R7506:Tnxb	UTSW	17	34715691	missense	possibly damaging	0.89
R7586:Tnxb	UTSW	17	34716408	missense	probably damaging	0.98
R7688:Tnxb	UTSW	17	34671906	missense	probably benign	0.23
R7690:Tnxb	UTSW	17	34689520	missense	probably benign	0.03
R7690:Tnxb	UTSW	17	34689527	missense	probably damaging	1.00
R7732:Tnxb	UTSW	17	34694280	missense	probably damaging	1.00
R7735:Tnxb	UTSW	17	34671424	missense	unknown
R7760:Tnxb	UTSW	17	34712937	missense	probably damaging	0.96
R7874:Tnxb	UTSW	17	34711443	missense	probably damaging	1.00
R7909:Tnxb	UTSW	17	34692454	missense	probably benign	0.02
R7922:Tnxb	UTSW	17	34714603	missense	probably damaging	1.00
R7931:Tnxb	UTSW	17	34688698	missense	probably damaging	1.00
R7949:Tnxb	UTSW	17	34717129	missense	probably damaging	1.00
R7953:Tnxb	UTSW	17	34709535	missense	possibly damaging	0.86
R7953:Tnxb	UTSW	17	34710103	missense	probably benign	0.03
R7977:Tnxb	UTSW	17	34710220	missense	possibly damaging	0.92
R7985:Tnxb	UTSW	17	34717010	critical splice donor site	probably null
R7987:Tnxb	UTSW	17	34710220	missense	possibly damaging	0.92
R8040:Tnxb	UTSW	17	34716558	missense	probably damaging	1.00
R8053:Tnxb	UTSW	17	34704179	missense	probably damaging	0.98
R8074:Tnxb	UTSW	17	34703981	missense	probably benign	0.32
R8089:Tnxb	UTSW	17	34672789	missense	unknown
R8169:Tnxb	UTSW	17	34699207	missense	possibly damaging	0.96
R8348:Tnxb	UTSW	17	34710128	missense	possibly damaging	0.92
R8352:Tnxb	UTSW	17	34689407	missense	probably damaging	1.00
R8362:Tnxb	UTSW	17	34712972	missense	probably damaging	0.99
R8452:Tnxb	UTSW	17	34689407	missense	probably damaging	1.00
R8527:Tnxb	UTSW	17	34688660	missense	probably damaging	1.00
R8754:Tnxb	UTSW	17	34715908	missense	probably damaging	1.00
R8813:Tnxb	UTSW	17	34719162	missense	probably damaging	1.00
R8936:Tnxb	UTSW	17	34685672	missense	probably damaging	1.00
R8986:Tnxb	UTSW	17	34678672	missense	possibly damaging	0.66
R9001:Tnxb	UTSW	17	34703436	missense	probably benign	0.32
R9215:Tnxb	UTSW	17	34672590	missense	unknown
R9226:Tnxb	UTSW	17	34685792	missense	probably damaging	1.00
R9276:Tnxb	UTSW	17	34710160	missense	possibly damaging	0.60
R9279:Tnxb	UTSW	17	34679114	missense	possibly damaging	0.46
R9363:Tnxb	UTSW	17	34698320	missense	possibly damaging	0.93
R9367:Tnxb	UTSW	17	34713019	missense	probably damaging	1.00
R9494:Tnxb	UTSW	17	34685822	missense	probably damaging	1.00
R9606:Tnxb	UTSW	17	34695604	missense	possibly damaging	0.82
R9650:Tnxb	UTSW	17	34711655	missense	probably damaging	0.99
R9677:Tnxb	UTSW	17	34698904	missense	possibly damaging	0.93
R9690:Tnxb	UTSW	17	34717197	missense	probably damaging	1.00
R9761:Tnxb	UTSW	17	34685013	missense	probably benign	0.32
X0004:Tnxb	UTSW	17	34703415	missense	possibly damaging	0.71
X0010:Tnxb	UTSW	17	34671934	missense	probably damaging	1.00
X0019:Tnxb	UTSW	17	34694189	missense	possibly damaging	0.51
X0063:Tnxb	UTSW	17	34703508	missense	probably damaging	0.98
X0064:Tnxb	UTSW	17	34694032	missense	probably damaging	1.00
Z1177:Tnxb	UTSW	17	34671766	missense	unknown
Z1177:Tnxb	UTSW	17	34683331	missense	probably damaging	1.00
Z1177:Tnxb	UTSW	17	34718726	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTAGGGATTCTACCTCACC -3'
(R):5'- AAAAGGGTCATCATTGGAGCC -3'

Sequencing Primer
(F):5'- TCCTTCTCAGCTGCAGAGGAAG -3'
(R):5'- AAGGACCTGGGTTCAATTCC -3'

Posted On

2016-07-22