Mutagenetix > Incidental Mutations

Incidental Mutation 'R5223:Skiv2l'

402464

Institutional Source

Beutler Lab

Gene Symbol

Skiv2l

Ensembl Gene

ENSMUSG00000040356

Gene Name

superkiller viralicidic activity 2-like (S. cerevisiae)

Synonyms

4930534J06Rik, Ski2w

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34839228-34850210 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 34845166 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000046022] [ENSMUST00000172966] [ENSMUST00000173415]

Predicted Effect

probably null
Transcript: ENSMUST00000046022

SMART Domains

Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	171	176	N/A	INTRINSIC
low complexity region	208	237	N/A	INTRINSIC
low complexity region	269	279	N/A	INTRINSIC
DEXDc	304	487	3.61e-28	SMART
low complexity region	583	592	N/A	INTRINSIC
HELICc	619	705	8.63e-17	SMART
Pfam:rRNA_proc-arch	760	1044	9.7e-39	PFAM
DSHCT	1067	1243	7.67e-77	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000046022

SMART Domains

Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	171	176	N/A	INTRINSIC
low complexity region	208	237	N/A	INTRINSIC
low complexity region	269	279	N/A	INTRINSIC
DEXDc	304	487	3.61e-28	SMART
low complexity region	583	592	N/A	INTRINSIC
HELICc	619	705	8.63e-17	SMART
Pfam:rRNA_proc-arch	760	1044	9.7e-39	PFAM
DSHCT	1067	1243	7.67e-77	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172686

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172878

Predicted Effect

probably benign
Transcript: ENSMUST00000172966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173305

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173403

Predicted Effect

probably benign
Transcript: ENSMUST00000173415

SMART Domains

Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

Domain	Start	End	E-Value	Type
PDB:4A4Z\|A	10	81	8e-14	PDB
Blast:DEXDc	19	76	2e-29	BLAST
Blast:DEXDc	136	242	9e-28	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174226

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174887

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184474

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Skiv2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Skiv2l	APN	17	34839548	missense	probably damaging	1.00
IGL00338:Skiv2l	APN	17	34846667	missense	probably damaging	0.99
IGL01284:Skiv2l	APN	17	34839688	unclassified	probably benign
IGL01308:Skiv2l	APN	17	34840634	missense	probably benign	0.19
IGL01874:Skiv2l	APN	17	34841209	missense	probably benign
IGL02114:Skiv2l	APN	17	34841116	missense	probably damaging	0.97
IGL02208:Skiv2l	APN	17	34841675	missense	probably damaging	0.99
IGL02274:Skiv2l	APN	17	34845863	missense	probably damaging	1.00
IGL02729:Skiv2l	APN	17	34839605	missense	possibly damaging	0.63
IGL02839:Skiv2l	APN	17	34847798	missense	probably benign
R0325:Skiv2l	UTSW	17	34844815	missense	possibly damaging	0.50
R1102:Skiv2l	UTSW	17	34840106	missense	probably benign	0.28
R1294:Skiv2l	UTSW	17	34841064	splice site	probably null
R1513:Skiv2l	UTSW	17	34847444	missense	probably damaging	1.00
R1557:Skiv2l	UTSW	17	34848422	missense	probably damaging	1.00
R1747:Skiv2l	UTSW	17	34847806	missense	probably benign	0.02
R2401:Skiv2l	UTSW	17	34840385	missense	probably benign
R3162:Skiv2l	UTSW	17	34847813	nonsense	probably null
R3162:Skiv2l	UTSW	17	34847813	nonsense	probably null
R3695:Skiv2l	UTSW	17	34847912	missense	probably damaging	1.00
R3700:Skiv2l	UTSW	17	34849903	missense	probably benign
R4654:Skiv2l	UTSW	17	34849946	missense	probably damaging	1.00
R4736:Skiv2l	UTSW	17	34848197	missense	possibly damaging	0.91
R4835:Skiv2l	UTSW	17	34842921	missense	possibly damaging	0.66
R5014:Skiv2l	UTSW	17	34847425	missense	probably benign	0.00
R5181:Skiv2l	UTSW	17	34844826	missense	probably benign	0.44
R5417:Skiv2l	UTSW	17	34846598	missense	probably damaging	0.98
R5623:Skiv2l	UTSW	17	34847432	missense	probably benign	0.00
R5878:Skiv2l	UTSW	17	34846117	missense	possibly damaging	0.83
R5979:Skiv2l	UTSW	17	34841463	missense	probably benign	0.01
R6412:Skiv2l	UTSW	17	34840300	missense	possibly damaging	0.92
R6501:Skiv2l	UTSW	17	34844436	missense	possibly damaging	0.95
R6532:Skiv2l	UTSW	17	34844743	missense	probably damaging	1.00
R6730:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6732:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6741:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6742:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6769:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6771:Skiv2l	UTSW	17	34845190	nonsense	probably null
R7022:Skiv2l	UTSW	17	34845207	missense	possibly damaging	0.88
R7096:Skiv2l	UTSW	17	34841470	missense	probably benign
R7178:Skiv2l	UTSW	17	34839464	missense	probably benign
R7315:Skiv2l	UTSW	17	34841169	missense	probably benign	0.00
R7584:Skiv2l	UTSW	17	34841675	missense	possibly damaging	0.69
R7677:Skiv2l	UTSW	17	34848164	missense	probably benign	0.03
R7796:Skiv2l	UTSW	17	34844418	missense	probably damaging	1.00
R8071:Skiv2l	UTSW	17	34849999	missense	probably benign	0.22
Z1176:Skiv2l	UTSW	17	34841546	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAGATTGAGTGGTCCCAGC -3'
(R):5'- TTCTTGAACCGGTTGGATCAG -3'

Sequencing Primer
(F):5'- AGCCCTCACCTGTGCAG -3'
(R):5'- TTCTGGGCCTTAGAAGAAACTGCC -3'

Posted On

2016-07-22