Incidental Mutation 'R5223:Rbbp8'
ID402468
Institutional Source Beutler Lab
Gene Symbol Rbbp8
Ensembl Gene ENSMUSG00000041238
Gene Nameretinoblastoma binding protein 8, endonuclease
Synonyms9930104E21Rik, CtIP
MMRRC Submission 042796-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5223 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location11633276-11743207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11721690 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 324 (A324E)
Ref Sequence ENSEMBL: ENSMUSP00000111527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]
AlphaFold Q80YR6
Predicted Effect probably benign
Transcript: ENSMUST00000047322
AA Change: A324E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: A324E

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 9.6e-61 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 790 854 8.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115861
AA Change: A324E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: A324E

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 5.2e-55 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 817 854 1.4e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Gpnmb C T 6: 49,056,205 T539M probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Nhsl1 T A 10: 18,526,326 V1100E probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pacs1 C T 19: 5,145,141 V472I probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Slc4a10 G A 2: 62,253,366 G388S probably damaging Het
Smtn G T 11: 3,529,530 N512K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Tpo T A 12: 30,092,590 I712F probably damaging Het
Trim62 T C 4: 128,909,411 V418A probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zfp738 G T 13: 67,673,063 T55K probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Rbbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rbbp8 APN 18 11722607 missense probably benign
IGL01302:Rbbp8 APN 18 11721979 missense probably benign
IGL01965:Rbbp8 APN 18 11722260 missense probably benign 0.04
IGL02076:Rbbp8 APN 18 11705819 missense probably damaging 1.00
IGL02410:Rbbp8 APN 18 11732212 missense probably damaging 1.00
IGL02823:Rbbp8 APN 18 11732213 missense possibly damaging 0.89
IGL02859:Rbbp8 APN 18 11738614 missense probably benign 0.42
IGL02966:Rbbp8 APN 18 11705812 missense possibly damaging 0.88
IGL03022:Rbbp8 APN 18 11725502 splice site probably benign
IGL03274:Rbbp8 APN 18 11741076 splice site probably benign
IGL03367:Rbbp8 APN 18 11721719 missense probably benign 0.08
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0167:Rbbp8 UTSW 18 11660922 nonsense probably null
R0314:Rbbp8 UTSW 18 11715818 missense probably benign 0.17
R0864:Rbbp8 UTSW 18 11732184 splice site probably benign
R1033:Rbbp8 UTSW 18 11742705 missense probably benign 0.41
R1678:Rbbp8 UTSW 18 11732315 missense probably benign 0.05
R1964:Rbbp8 UTSW 18 11742679 missense possibly damaging 0.62
R2002:Rbbp8 UTSW 18 11727166 splice site probably benign
R2015:Rbbp8 UTSW 18 11720624 missense probably benign 0.01
R2240:Rbbp8 UTSW 18 11677669 missense probably damaging 0.99
R2308:Rbbp8 UTSW 18 11696776 missense possibly damaging 0.95
R3946:Rbbp8 UTSW 18 11718868 missense probably benign
R4375:Rbbp8 UTSW 18 11725410 missense probably benign 0.00
R4590:Rbbp8 UTSW 18 11732265 nonsense probably null
R4695:Rbbp8 UTSW 18 11721782 nonsense probably null
R4769:Rbbp8 UTSW 18 11722670 missense probably damaging 1.00
R5161:Rbbp8 UTSW 18 11722114 missense probably damaging 1.00
R5195:Rbbp8 UTSW 18 11722151 missense probably benign 0.00
R5573:Rbbp8 UTSW 18 11722607 missense probably benign
R5671:Rbbp8 UTSW 18 11742642 missense probably benign 0.00
R6051:Rbbp8 UTSW 18 11738607 missense probably benign 0.17
R6995:Rbbp8 UTSW 18 11718908 missense probably damaging 1.00
R7048:Rbbp8 UTSW 18 11732220 missense possibly damaging 0.92
R7261:Rbbp8 UTSW 18 11705742 missense probably damaging 0.99
R7305:Rbbp8 UTSW 18 11672581 critical splice acceptor site probably null
R7319:Rbbp8 UTSW 18 11732212 missense probably damaging 1.00
R7447:Rbbp8 UTSW 18 11660877 missense probably benign 0.00
R7949:Rbbp8 UTSW 18 11718835 missense probably benign 0.00
R8010:Rbbp8 UTSW 18 11722233 missense possibly damaging 0.67
R8116:Rbbp8 UTSW 18 11722670 missense probably damaging 1.00
R8292:Rbbp8 UTSW 18 11705712 missense probably benign
R8300:Rbbp8 UTSW 18 11705776 synonymous silent
R8314:Rbbp8 UTSW 18 11720625 missense probably benign 0.06
R8510:Rbbp8 UTSW 18 11696802 nonsense probably null
R8961:Rbbp8 UTSW 18 11732205 missense probably benign 0.18
R9056:Rbbp8 UTSW 18 11677620 missense possibly damaging 0.65
R9086:Rbbp8 UTSW 18 11742679 missense possibly damaging 0.62
Z1176:Rbbp8 UTSW 18 11732262 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAAAAGTCCTCAGTGGGC -3'
(R):5'- GGCATTATCCTCAGATTTGGATC -3'

Sequencing Primer
(F):5'- GAAACCACTGCATCTTACATTTGTG -3'
(R):5'- CTAACTTTCTCTGATCTAGAAACAGC -3'
Posted On2016-07-22