Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Rbbp8'

402468

Institutional Source

Beutler Lab

Gene Symbol

Rbbp8

Ensembl Gene

ENSMUSG00000041238

Gene Name

retinoblastoma binding protein 8, endonuclease

Synonyms

9930104E21Rik, CtIP

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11633276-11743207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 11721690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 324 (A324E)

Ref Sequence

ENSEMBL: ENSMUSP00000111527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]

AlphaFold

Q80YR6

Predicted Effect

probably benign
Transcript: ENSMUST00000047322
AA Change: A324E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: A324E

Domain	Start	End	E-Value	Type
Pfam:CtIP_N	20	139	9.6e-61	PFAM
PDB:2L4Z\|A	639	675	3e-15	PDB
Pfam:SAE2	790	854	8.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115861
AA Change: A324E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: A324E

Domain	Start	End	E-Value	Type
Pfam:CtIP_N	20	139	5.2e-55	PFAM
PDB:2L4Z\|A	639	675	3e-15	PDB
Pfam:SAE2	817	854	1.4e-8	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pacs1	C	T	19: 5,145,141	V472I	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Rbbp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Rbbp8	APN	18	11722607	missense	probably benign
IGL01302:Rbbp8	APN	18	11721979	missense	probably benign
IGL01965:Rbbp8	APN	18	11722260	missense	probably benign	0.04
IGL02076:Rbbp8	APN	18	11705819	missense	probably damaging	1.00
IGL02410:Rbbp8	APN	18	11732212	missense	probably damaging	1.00
IGL02823:Rbbp8	APN	18	11732213	missense	possibly damaging	0.89
IGL02859:Rbbp8	APN	18	11738614	missense	probably benign	0.42
IGL02966:Rbbp8	APN	18	11705812	missense	possibly damaging	0.88
IGL03022:Rbbp8	APN	18	11725502	splice site	probably benign
IGL03274:Rbbp8	APN	18	11741076	splice site	probably benign
IGL03367:Rbbp8	APN	18	11721719	missense	probably benign	0.08
R0063:Rbbp8	UTSW	18	11734557	splice site	probably benign
R0063:Rbbp8	UTSW	18	11734557	splice site	probably benign
R0167:Rbbp8	UTSW	18	11660922	nonsense	probably null
R0314:Rbbp8	UTSW	18	11715818	missense	probably benign	0.17
R0864:Rbbp8	UTSW	18	11732184	splice site	probably benign
R1033:Rbbp8	UTSW	18	11742705	missense	probably benign	0.41
R1678:Rbbp8	UTSW	18	11732315	missense	probably benign	0.05
R1964:Rbbp8	UTSW	18	11742679	missense	possibly damaging	0.62
R2002:Rbbp8	UTSW	18	11727166	splice site	probably benign
R2015:Rbbp8	UTSW	18	11720624	missense	probably benign	0.01
R2240:Rbbp8	UTSW	18	11677669	missense	probably damaging	0.99
R2308:Rbbp8	UTSW	18	11696776	missense	possibly damaging	0.95
R3946:Rbbp8	UTSW	18	11718868	missense	probably benign
R4375:Rbbp8	UTSW	18	11725410	missense	probably benign	0.00
R4590:Rbbp8	UTSW	18	11732265	nonsense	probably null
R4695:Rbbp8	UTSW	18	11721782	nonsense	probably null
R4769:Rbbp8	UTSW	18	11722670	missense	probably damaging	1.00
R5161:Rbbp8	UTSW	18	11722114	missense	probably damaging	1.00
R5195:Rbbp8	UTSW	18	11722151	missense	probably benign	0.00
R5573:Rbbp8	UTSW	18	11722607	missense	probably benign
R5671:Rbbp8	UTSW	18	11742642	missense	probably benign	0.00
R6051:Rbbp8	UTSW	18	11738607	missense	probably benign	0.17
R6995:Rbbp8	UTSW	18	11718908	missense	probably damaging	1.00
R7048:Rbbp8	UTSW	18	11732220	missense	possibly damaging	0.92
R7261:Rbbp8	UTSW	18	11705742	missense	probably damaging	0.99
R7305:Rbbp8	UTSW	18	11672581	critical splice acceptor site	probably null
R7319:Rbbp8	UTSW	18	11732212	missense	probably damaging	1.00
R7447:Rbbp8	UTSW	18	11660877	missense	probably benign	0.00
R7949:Rbbp8	UTSW	18	11718835	missense	probably benign	0.00
R8010:Rbbp8	UTSW	18	11722233	missense	possibly damaging	0.67
R8116:Rbbp8	UTSW	18	11722670	missense	probably damaging	1.00
R8292:Rbbp8	UTSW	18	11705712	missense	probably benign
R8300:Rbbp8	UTSW	18	11705776	synonymous	silent
R8314:Rbbp8	UTSW	18	11720625	missense	probably benign	0.06
R8510:Rbbp8	UTSW	18	11696802	nonsense	probably null
R8961:Rbbp8	UTSW	18	11732205	missense	probably benign	0.18
R9056:Rbbp8	UTSW	18	11677620	missense	possibly damaging	0.65
R9086:Rbbp8	UTSW	18	11742679	missense	possibly damaging	0.62
R9375:Rbbp8	UTSW	18	11705831	missense	probably benign
R9391:Rbbp8	UTSW	18	11721933	missense	possibly damaging	0.49
R9763:Rbbp8	UTSW	18	11732204	missense	probably benign	0.01
Z1176:Rbbp8	UTSW	18	11732262	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCAAAAGTCCTCAGTGGGC -3'
(R):5'- GGCATTATCCTCAGATTTGGATC -3'

Sequencing Primer
(F):5'- GAAACCACTGCATCTTACATTTGTG -3'
(R):5'- CTAACTTTCTCTGATCTAGAAACAGC -3'

Posted On

2016-07-22