Mutagenetix > Incidental Mutation

Incidental Mutation 'R5223:Pacs1'

402471

Institutional Source

Beutler Lab

Gene Symbol

Pacs1

Ensembl Gene

ENSMUSG00000024855

Gene Name

phosphofurin acidic cluster sorting protein 1

Synonyms

MMRRC Submission

042796-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5133688-5273119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5145141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 472 (V472I)

Ref Sequence

ENSEMBL: ENSMUSP00000025786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025786]

AlphaFold

Q8K212

Predicted Effect

probably benign
Transcript: ENSMUST00000025786
AA Change: V472I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: V472I

Domain	Start	End	E-Value	Type
low complexity region	5	24	N/A	INTRINSIC
low complexity region	27	46	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
low complexity region	276	290	N/A	INTRINSIC
low complexity region	306	320	N/A	INTRINSIC
low complexity region	359	372	N/A	INTRINSIC
Pfam:Pacs-1	546	958	2e-193	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,013,452	V273M	possibly damaging	Het
Acin1	CCGC	CC	14: 54,642,941		probably null	Het
Acvr1b	T	A	15: 101,193,976	C46S	probably damaging	Het
Ahi1	A	T	10: 20,970,919	H416L	possibly damaging	Het
Aspm	T	A	1: 139,478,334	L1653Q	probably damaging	Het
Cacna1a	G	A	8: 84,587,195	V1533M	possibly damaging	Het
Ccdc33	C	T	9: 58,032,984	E502K	possibly damaging	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Cyp2a12	A	T	7: 27,036,463		probably null	Het
Ep400	A	G	5: 110,668,630	V2675A	probably damaging	Het
Foxh1	T	A	15: 76,668,729		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm10093	A	G	17: 78,492,438	E286G	probably benign	Het
Gm13078	T	A	4: 143,728,021	S296R	probably benign	Het
Gpnmb	C	T	6: 49,056,205	T539M	probably benign	Het
Hspa9	A	G	18: 34,952,671		probably null	Het
Hspg2	T	C	4: 137,543,914	L2454P	probably damaging	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Igkv6-32	T	C	6: 70,074,223	S50G	probably benign	Het
Il23r	T	A	6: 67,486,170	Y113F	probably benign	Het
Kcnt1	A	G	2: 25,903,422	D636G	probably benign	Het
Klhl41	G	A	2: 69,679,827	W569*	probably null	Het
Klra4	T	A	6: 130,062,147	D94V	probably damaging	Het
Lca5	T	A	9: 83,398,613	H378L	probably benign	Het
Lhx8	T	A	3: 154,321,644	T254S	probably damaging	Het
Lrch3	C	T	16: 32,914,397	R86W	probably damaging	Het
Lrp2	T	A	2: 69,524,053	N477I	probably damaging	Het
Man2a1	T	A	17: 64,712,271	I710K	probably benign	Het
Ncor1	A	T	11: 62,339,000	Y881N	probably damaging	Het
Nhsl1	T	A	10: 18,526,326	V1100E	probably damaging	Het
Olfr1208	T	C	2: 88,897,334	T88A	probably benign	Het
Olfr486	A	G	7: 108,172,708	V12A	probably benign	Het
Olfr855	T	C	9: 19,585,026	V163A	probably benign	Het
Oprk1	T	C	1: 5,589,296	V83A	probably benign	Het
Pard3b	T	C	1: 62,344,113	Y789H	probably damaging	Het
Pcdha2	T	C	18: 36,940,791	Y492H	probably damaging	Het
Pcnt	T	C	10: 76,380,272	N2261D	probably damaging	Het
Pex5l	A	T	3: 32,958,796	S15T	probably damaging	Het
Plekhg4	A	G	8: 105,378,949	N682S	probably benign	Het
Poc5	A	T	13: 96,402,955	M335L	probably benign	Het
Polr1a	C	T	6: 71,967,907	R1316W	possibly damaging	Het
Pp2d1	T	C	17: 53,507,845	H617R	probably benign	Het
Prpsap1	T	C	11: 116,488,148	K65E	probably benign	Het
Ptgfrn	T	C	3: 101,045,593	E775G	probably benign	Het
Ptprc	T	A	1: 138,117,862	I87F	probably benign	Het
Rbbp8	C	A	18: 11,721,690	A324E	probably benign	Het
Rfx6	G	T	10: 51,677,996	G63*	probably null	Het
Rpl37a	T	C	1: 72,712,149	M47T	probably benign	Het
Samm50	T	G	15: 84,200,630	N187K	probably benign	Het
Skiv2l	A	G	17: 34,845,166		probably null	Het
Slamf9	T	C	1: 172,476,232	I48T	possibly damaging	Het
Slc2a12	A	G	10: 22,702,032	K576E	probably damaging	Het
Slc4a10	G	A	2: 62,253,366	G388S	probably damaging	Het
Smtn	G	T	11: 3,529,530	N512K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sspo	A	G	6: 48,478,324	Y3040C	probably damaging	Het
Stat1	T	A	1: 52,144,242	V389E	probably damaging	Het
Sult5a1	A	T	8: 123,145,422	M227K	probably damaging	Het
Thsd4	T	C	9: 60,057,042	D389G	probably damaging	Het
Tnxb	T	C	17: 34,704,078	V2545A	possibly damaging	Het
Tpo	T	A	12: 30,092,590	I712F	probably damaging	Het
Trim62	T	C	4: 128,909,411	V418A	probably damaging	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r66	T	C	7: 85,007,885	D104G	probably benign	Het
Wdr26	T	C	1: 181,187,686	I371V	probably benign	Het
Wdr78	T	A	4: 103,049,403	S738C	possibly damaging	Het
Zfp273	T	G	13: 67,826,179	C475W	probably damaging	Het
Zfp738	G	T	13: 67,673,063	T55K	probably damaging	Het
Zmym2	A	G	14: 56,946,514	I978V	probably benign	Het

Other mutations in Pacs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Pacs1	APN	19	5153698	missense	probably damaging	0.98
IGL01335:Pacs1	APN	19	5142632	missense	probably damaging	1.00
IGL01717:Pacs1	APN	19	5167972	missense	probably damaging	1.00
IGL02453:Pacs1	APN	19	5135005	missense	probably damaging	1.00
IGL02887:Pacs1	APN	19	5135110	splice site	probably benign
Batavian	UTSW	19	5156413	missense	possibly damaging	0.71
chicory	UTSW	19	5139297	missense	probably benign	0.33
endive	UTSW	19	5272583	nonsense	probably null
Escarole	UTSW	19	5156356	critical splice donor site	probably null
frisee	UTSW	19	5136791	missense	probably damaging	1.00
R0240:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R0240:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R0316:Pacs1	UTSW	19	5135121	splice site	silent
R0369:Pacs1	UTSW	19	5141698	missense	probably damaging	1.00
R0443:Pacs1	UTSW	19	5272583	nonsense	probably null
R0973:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R0973:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R0974:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R1202:Pacs1	UTSW	19	5135237	missense	probably damaging	1.00
R1672:Pacs1	UTSW	19	5152309	missense	probably benign	0.00
R1689:Pacs1	UTSW	19	5272615	unclassified	probably benign
R1842:Pacs1	UTSW	19	5155884	missense	probably damaging	0.96
R1847:Pacs1	UTSW	19	5153714	missense	probably damaging	0.99
R3884:Pacs1	UTSW	19	5155759	missense	probably damaging	0.99
R4577:Pacs1	UTSW	19	5143833	nonsense	probably null
R4630:Pacs1	UTSW	19	5156356	critical splice donor site	probably null
R5029:Pacs1	UTSW	19	5142271	missense	probably benign	0.03
R5198:Pacs1	UTSW	19	5139297	missense	probably benign	0.33
R5464:Pacs1	UTSW	19	5147207	missense	probably benign
R5695:Pacs1	UTSW	19	5136791	missense	probably damaging	1.00
R6128:Pacs1	UTSW	19	5152372	splice site	probably null
R6335:Pacs1	UTSW	19	5159977	missense	probably damaging	1.00
R6802:Pacs1	UTSW	19	5152784	missense	probably damaging	0.99
R6831:Pacs1	UTSW	19	5160795	missense	probably damaging	1.00
R7071:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R7200:Pacs1	UTSW	19	5156413	missense	possibly damaging	0.71
R7248:Pacs1	UTSW	19	5138975	missense	probably damaging	1.00
R7576:Pacs1	UTSW	19	5145120	missense	probably benign	0.09
R7682:Pacs1	UTSW	19	5152699	missense	probably damaging	0.99
R7715:Pacs1	UTSW	19	5141681	missense	probably benign	0.01
R7738:Pacs1	UTSW	19	5152350	missense	probably benign	0.11
R8339:Pacs1	UTSW	19	5142623	missense	probably damaging	1.00
R8930:Pacs1	UTSW	19	5135002	missense	probably damaging	1.00
R8932:Pacs1	UTSW	19	5135002	missense	probably damaging	1.00
R9043:Pacs1	UTSW	19	5138936	missense	probably benign	0.23
R9211:Pacs1	UTSW	19	5139029	missense	probably damaging	0.99
R9459:Pacs1	UTSW	19	5145070	critical splice donor site	probably null
R9584:Pacs1	UTSW	19	5272594	missense	probably benign
R9608:Pacs1	UTSW	19	5143834	missense	probably damaging	1.00
R9732:Pacs1	UTSW	19	5134969	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCAATAGCCATTTCAACCC -3'
(R):5'- TAGGCAAAGCTCTGACGCAG -3'

Sequencing Primer
(F):5'- GGTCAATAGCCATTTCAACCCCAAAG -3'
(R):5'- ATGGGAGCACATGGCATCCAG -3'

Posted On

2016-07-22