Incidental Mutation 'R5224:Camk1g'
ID402476
Institutional Source Beutler Lab
Gene Symbol Camk1g
Ensembl Gene ENSMUSG00000016179
Gene Namecalcium/calmodulin-dependent protein kinase I gamma
SynonymsCLICK-III, CaMKIgamma
MMRRC Submission 042797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5224 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location193346346-193370298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 193355034 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 119 (D119E)
Ref Sequence ENSEMBL: ENSMUSP00000016323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016323] [ENSMUST00000169907]
Predicted Effect probably damaging
Transcript: ENSMUST00000016323
AA Change: D119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016323
Gene: ENSMUSG00000016179
AA Change: D119E

DomainStartEndE-ValueType
S_TKc 23 277 9.53e-112 SMART
low complexity region 376 389 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163202
AA Change: D65E
SMART Domains Protein: ENSMUSP00000131451
Gene: ENSMUSG00000016179
AA Change: D65E

DomainStartEndE-ValueType
S_TKc 2 238 5.19e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165718
Predicted Effect probably damaging
Transcript: ENSMUST00000169907
AA Change: D119E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128143
Gene: ENSMUSG00000016179
AA Change: D119E

DomainStartEndE-ValueType
S_TKc 23 277 9.53e-112 SMART
Meta Mutation Damage Score 0.3309 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to calcium/calmodulin dependent protein kinase, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,719,050 S1014R possibly damaging Het
Ahi1 A G 10: 20,987,022 S699G probably damaging Het
Atp10d C T 5: 72,269,326 A959V probably benign Het
Axl T C 7: 25,786,944 M112V probably benign Het
Btbd11 CGTGACCTTTCTGGT CGT 10: 85,645,522 probably benign Het
Capn8 A C 1: 182,596,989 N117T probably damaging Het
Cct3 G A 3: 88,297,225 probably benign Het
Csmd3 T C 15: 47,888,684 T1293A possibly damaging Het
D10Jhu81e A G 10: 78,163,533 V148A probably damaging Het
Depdc1b A G 13: 108,384,820 D387G probably damaging Het
Dtx3l A G 16: 35,938,793 Y29H possibly damaging Het
Erp44 A T 4: 48,279,435 N2K probably benign Het
Fmn1 A G 2: 113,365,125 E390G unknown Het
Ganab T A 19: 8,910,591 D396E probably benign Het
Gcc2 T A 10: 58,286,160 S1140T probably damaging Het
Gm10499 G A 17: 36,143,339 noncoding transcript Het
Gm7008 T C 12: 40,223,343 probably benign Het
Gphn T A 12: 78,590,587 F354I probably damaging Het
Hnrnpul1 G A 7: 25,745,175 T236M probably damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
Jaml T A 9: 45,104,266 M356K probably damaging Het
Kbtbd12 T A 6: 88,617,699 probably benign Het
Ldlrad3 G T 2: 102,113,609 N39K probably damaging Het
Lrp1b G A 2: 41,110,840 T2238I possibly damaging Het
Lypd8 T A 11: 58,386,808 C139S possibly damaging Het
Masp1 G T 16: 23,494,695 H163Q probably damaging Het
Mpo T C 11: 87,796,457 probably benign Het
Muc19 A T 15: 91,928,025 noncoding transcript Het
Muc5ac T A 7: 141,793,971 S438T probably benign Het
Nav2 T C 7: 49,551,725 V160A probably benign Het
Nlrc5 G T 8: 94,494,316 A1128S probably benign Het
Nlrp5 T A 7: 23,417,976 L375Q probably damaging Het
Nlrp9a A G 7: 26,557,292 T112A probably benign Het
Nppa T C 4: 148,001,316 S127P probably damaging Het
Olfr1058 A G 2: 86,385,849 S190P possibly damaging Het
Osbpl1a T C 18: 12,933,696 N2S probably benign Het
Otoa A G 7: 121,139,793 T742A probably damaging Het
Pcdh10 A G 3: 45,392,814 R1015G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plpp1 T A 13: 112,851,512 Y56* probably null Het
Ppp1r12a A G 10: 108,261,025 T236A probably benign Het
Rhag T C 17: 40,828,504 L110P probably damaging Het
Scn11a T A 9: 119,754,792 N1586Y probably damaging Het
Sgms2 T A 3: 131,342,117 K36I probably damaging Het
Slc22a2 A G 17: 12,586,832 N157D probably damaging Het
Stx19 T G 16: 62,822,574 M251R probably benign Het
Suco A G 1: 161,834,705 I719T probably benign Het
Tnr A G 1: 159,923,315 D1282G probably damaging Het
Tram1 T C 1: 13,578,125 R154G probably benign Het
Ubtfl1 G T 9: 18,410,030 V285L probably benign Het
Ugt2b38 A G 5: 87,423,742 S144P probably benign Het
Washc2 T G 6: 116,209,004 *58G probably null Het
Zfp354a T A 11: 51,070,049 S362R probably damaging Het
Other mutations in Camk1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Camk1g APN 1 193347349 unclassified probably benign
IGL02637:Camk1g APN 1 193348388 missense probably benign 0.38
I2288:Camk1g UTSW 1 193351106 splice site probably benign
R0375:Camk1g UTSW 1 193356401 splice site probably benign
R0433:Camk1g UTSW 1 193354058 missense probably damaging 0.99
R0967:Camk1g UTSW 1 193350296 missense probably damaging 1.00
R1161:Camk1g UTSW 1 193348354 missense probably benign
R1227:Camk1g UTSW 1 193347433 missense possibly damaging 0.73
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1641:Camk1g UTSW 1 193356357 missense probably benign 0.25
R3109:Camk1g UTSW 1 193354993 missense probably damaging 1.00
R3160:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3161:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R4638:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4642:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4644:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4756:Camk1g UTSW 1 193362085 missense probably benign 0.03
R4781:Camk1g UTSW 1 193356344 missense probably benign 0.00
R4987:Camk1g UTSW 1 193348475 missense probably damaging 0.99
R5407:Camk1g UTSW 1 193347372 splice site probably null
R5932:Camk1g UTSW 1 193354039 missense probably benign 0.25
R6725:Camk1g UTSW 1 193350320 missense possibly damaging 0.80
R7071:Camk1g UTSW 1 193359809 missense probably benign 0.10
R7808:Camk1g UTSW 1 193350285 missense possibly damaging 0.51
R7908:Camk1g UTSW 1 193359774 missense probably damaging 1.00
R8135:Camk1g UTSW 1 193354027 missense possibly damaging 0.79
Z1176:Camk1g UTSW 1 193362100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGGTTGTCTATGCTCAGC -3'
(R):5'- CCCCAGTGATAGCTCAGTTACC -3'

Sequencing Primer
(F):5'- TGCTCAGCATAAGGAATCTTAGGGC -3'
(R):5'- CTCAGTTACCCAGAAGGAGTGTC -3'
Posted On2016-07-22