Incidental Mutation 'R5224:Pcdh10'
ID402482
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 042797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5224 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45392814 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1015 (R1015G)
Ref Sequence ENSEMBL: ENSMUSP00000131600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554]
Predicted Effect probably damaging
Transcript: ENSMUST00000166126
AA Change: R1015G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: R1015G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170695
AA Change: R1015G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: R1015G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171554
AA Change: R1015G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: R1015G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Meta Mutation Damage Score 0.1505 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,719,050 S1014R possibly damaging Het
Ahi1 A G 10: 20,987,022 S699G probably damaging Het
Atp10d C T 5: 72,269,326 A959V probably benign Het
Axl T C 7: 25,786,944 M112V probably benign Het
Btbd11 CGTGACCTTTCTGGT CGT 10: 85,645,522 probably benign Het
Camk1g A T 1: 193,355,034 D119E probably damaging Het
Capn8 A C 1: 182,596,989 N117T probably damaging Het
Cct3 G A 3: 88,297,225 probably benign Het
Csmd3 T C 15: 47,888,684 T1293A possibly damaging Het
D10Jhu81e A G 10: 78,163,533 V148A probably damaging Het
Depdc1b A G 13: 108,384,820 D387G probably damaging Het
Dtx3l A G 16: 35,938,793 Y29H possibly damaging Het
Erp44 A T 4: 48,279,435 N2K probably benign Het
Fmn1 A G 2: 113,365,125 E390G unknown Het
Ganab T A 19: 8,910,591 D396E probably benign Het
Gcc2 T A 10: 58,286,160 S1140T probably damaging Het
Gm10499 G A 17: 36,143,339 noncoding transcript Het
Gm7008 T C 12: 40,223,343 probably benign Het
Gphn T A 12: 78,590,587 F354I probably damaging Het
Hnrnpul1 G A 7: 25,745,175 T236M probably damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
Jaml T A 9: 45,104,266 M356K probably damaging Het
Kbtbd12 T A 6: 88,617,699 probably benign Het
Ldlrad3 G T 2: 102,113,609 N39K probably damaging Het
Lrp1b G A 2: 41,110,840 T2238I possibly damaging Het
Lypd8 T A 11: 58,386,808 C139S possibly damaging Het
Masp1 G T 16: 23,494,695 H163Q probably damaging Het
Mpo T C 11: 87,796,457 probably benign Het
Muc19 A T 15: 91,928,025 noncoding transcript Het
Muc5ac T A 7: 141,793,971 S438T probably benign Het
Nav2 T C 7: 49,551,725 V160A probably benign Het
Nlrc5 G T 8: 94,494,316 A1128S probably benign Het
Nlrp5 T A 7: 23,417,976 L375Q probably damaging Het
Nlrp9a A G 7: 26,557,292 T112A probably benign Het
Nppa T C 4: 148,001,316 S127P probably damaging Het
Olfr1058 A G 2: 86,385,849 S190P possibly damaging Het
Osbpl1a T C 18: 12,933,696 N2S probably benign Het
Otoa A G 7: 121,139,793 T742A probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plpp1 T A 13: 112,851,512 Y56* probably null Het
Ppp1r12a A G 10: 108,261,025 T236A probably benign Het
Rhag T C 17: 40,828,504 L110P probably damaging Het
Scn11a T A 9: 119,754,792 N1586Y probably damaging Het
Sgms2 T A 3: 131,342,117 K36I probably damaging Het
Slc22a2 A G 17: 12,586,832 N157D probably damaging Het
Stx19 T G 16: 62,822,574 M251R probably benign Het
Suco A G 1: 161,834,705 I719T probably benign Het
Tnr A G 1: 159,923,315 D1282G probably damaging Het
Tram1 T C 1: 13,578,125 R154G probably benign Het
Ubtfl1 G T 9: 18,410,030 V285L probably benign Het
Ugt2b38 A G 5: 87,423,742 S144P probably benign Het
Washc2 T G 6: 116,209,004 *58G probably null Het
Zfp354a T A 11: 51,070,049 S362R probably damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45381375 missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45381197 missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45380222 missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45379259 missense probably benign 0.00
R8082:Pcdh10 UTSW 3 45381744 missense probably damaging 1.00
R8302:Pcdh10 UTSW 3 45381498 missense probably damaging 0.99
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45381729 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTGTCCCTTCGGATGGACG -3'
(R):5'- CATCAGAGCCCATCTTCCTG -3'

Sequencing Primer
(F):5'- ACGCCAGGCTGCAGATTAC -3'
(R):5'- AGAGCCCATCTTCCTGCTAACTG -3'
Posted On2016-07-22