Incidental Mutation 'R5224:Erp44'
ID402485
Institutional Source Beutler Lab
Gene Symbol Erp44
Ensembl Gene ENSMUSG00000028343
Gene Nameendoplasmic reticulum protein 44
Synonyms1110001E24Rik, Txndc4
MMRRC Submission 042797-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5224 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location48193323-48279558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48279435 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2 (N2K)
Ref Sequence ENSEMBL: ENSMUSP00000030028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030028] [ENSMUST00000030029] [ENSMUST00000143433]
Predicted Effect probably benign
Transcript: ENSMUST00000030028
AA Change: N2K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030028
Gene: ENSMUSG00000028343
AA Change: N2K

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:Calsequestrin 29 205 6.4e-12 PFAM
Pfam:Thioredoxin 30 139 1.1e-23 PFAM
Pfam:Thioredoxin_6 167 350 8.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030029
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156602
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins. It has an inferred N-terminal signal peptide, a catalytically active thioredoxin (TRX) domain, two TRX-like domains and a C-terminal ER-retention sequence. This protein functions as a pH-regulated chaperone of the secretory pathway and likely plays a role in protein quality control at the endoplasmic reticulum - Golgi interface. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit light coat colour, small stature and scaly tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,719,050 S1014R possibly damaging Het
Ahi1 A G 10: 20,987,022 S699G probably damaging Het
Atp10d C T 5: 72,269,326 A959V probably benign Het
Axl T C 7: 25,786,944 M112V probably benign Het
Btbd11 CGTGACCTTTCTGGT CGT 10: 85,645,522 probably benign Het
Camk1g A T 1: 193,355,034 D119E probably damaging Het
Capn8 A C 1: 182,596,989 N117T probably damaging Het
Cct3 G A 3: 88,297,225 probably benign Het
Csmd3 T C 15: 47,888,684 T1293A possibly damaging Het
D10Jhu81e A G 10: 78,163,533 V148A probably damaging Het
Depdc1b A G 13: 108,384,820 D387G probably damaging Het
Dtx3l A G 16: 35,938,793 Y29H possibly damaging Het
Fmn1 A G 2: 113,365,125 E390G unknown Het
Ganab T A 19: 8,910,591 D396E probably benign Het
Gcc2 T A 10: 58,286,160 S1140T probably damaging Het
Gm10499 G A 17: 36,143,339 noncoding transcript Het
Gm7008 T C 12: 40,223,343 probably benign Het
Gphn T A 12: 78,590,587 F354I probably damaging Het
Hnrnpul1 G A 7: 25,745,175 T236M probably damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
Jaml T A 9: 45,104,266 M356K probably damaging Het
Kbtbd12 T A 6: 88,617,699 probably benign Het
Ldlrad3 G T 2: 102,113,609 N39K probably damaging Het
Lrp1b G A 2: 41,110,840 T2238I possibly damaging Het
Lypd8 T A 11: 58,386,808 C139S possibly damaging Het
Masp1 G T 16: 23,494,695 H163Q probably damaging Het
Mpo T C 11: 87,796,457 probably benign Het
Muc19 A T 15: 91,928,025 noncoding transcript Het
Muc5ac T A 7: 141,793,971 S438T probably benign Het
Nav2 T C 7: 49,551,725 V160A probably benign Het
Nlrc5 G T 8: 94,494,316 A1128S probably benign Het
Nlrp5 T A 7: 23,417,976 L375Q probably damaging Het
Nlrp9a A G 7: 26,557,292 T112A probably benign Het
Nppa T C 4: 148,001,316 S127P probably damaging Het
Olfr1058 A G 2: 86,385,849 S190P possibly damaging Het
Osbpl1a T C 18: 12,933,696 N2S probably benign Het
Otoa A G 7: 121,139,793 T742A probably damaging Het
Pcdh10 A G 3: 45,392,814 R1015G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plpp1 T A 13: 112,851,512 Y56* probably null Het
Ppp1r12a A G 10: 108,261,025 T236A probably benign Het
Rhag T C 17: 40,828,504 L110P probably damaging Het
Scn11a T A 9: 119,754,792 N1586Y probably damaging Het
Sgms2 T A 3: 131,342,117 K36I probably damaging Het
Slc22a2 A G 17: 12,586,832 N157D probably damaging Het
Stx19 T G 16: 62,822,574 M251R probably benign Het
Suco A G 1: 161,834,705 I719T probably benign Het
Tnr A G 1: 159,923,315 D1282G probably damaging Het
Tram1 T C 1: 13,578,125 R154G probably benign Het
Ubtfl1 G T 9: 18,410,030 V285L probably benign Het
Ugt2b38 A G 5: 87,423,742 S144P probably benign Het
Washc2 T G 6: 116,209,004 *58G probably null Het
Zfp354a T A 11: 51,070,049 S362R probably damaging Het
Other mutations in Erp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Erp44 APN 4 48218126 missense probably benign 0.22
IGL02057:Erp44 APN 4 48236964 missense probably benign 0.05
IGL03165:Erp44 APN 4 48236872 critical splice donor site probably null
IGL03253:Erp44 APN 4 48208750 missense probably benign 0.09
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R4976:Erp44 UTSW 4 48208797 missense probably benign 0.01
R5024:Erp44 UTSW 4 48241296 nonsense probably null
R5175:Erp44 UTSW 4 48196823 missense probably benign 0.41
R5359:Erp44 UTSW 4 48211704 missense probably benign
R6128:Erp44 UTSW 4 48243493 missense probably damaging 0.98
R6248:Erp44 UTSW 4 48219479 nonsense probably null
R6649:Erp44 UTSW 4 48205130 missense probably null 0.01
R6653:Erp44 UTSW 4 48205130 missense probably null 0.01
R6911:Erp44 UTSW 4 48204268 missense probably benign 0.17
R7061:Erp44 UTSW 4 48219375 missense probably benign
R7209:Erp44 UTSW 4 48211704 missense probably benign
R7291:Erp44 UTSW 4 48208792 missense probably damaging 1.00
R7369:Erp44 UTSW 4 48218183 missense probably benign
R7703:Erp44 UTSW 4 48196904 missense probably benign 0.09
R7785:Erp44 UTSW 4 48243531 missense probably benign 0.04
R7992:Erp44 UTSW 4 48218136 missense possibly damaging 0.57
R8213:Erp44 UTSW 4 48208783 missense probably benign 0.03
R8332:Erp44 UTSW 4 48243475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCAAAGTGAAGGTAGTGCC -3'
(R):5'- ATTTCCCGACGTGCTTCGAG -3'

Sequencing Primer
(F):5'- TGAAGGTAGTGCCCGGGG -3'
(R):5'- TGCTTCGAGATGGGCAGGAC -3'
Posted On2016-07-22