Incidental Mutation 'R5224:Scn11a'
ID402505
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 042797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5224 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119754792 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1586 (N1586Y)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: N1586Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: N1586Y

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: N1586Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4105 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,719,050 S1014R possibly damaging Het
Ahi1 A G 10: 20,987,022 S699G probably damaging Het
Atp10d C T 5: 72,269,326 A959V probably benign Het
Axl T C 7: 25,786,944 M112V probably benign Het
Btbd11 CGTGACCTTTCTGGT CGT 10: 85,645,522 probably benign Het
Camk1g A T 1: 193,355,034 D119E probably damaging Het
Capn8 A C 1: 182,596,989 N117T probably damaging Het
Cct3 G A 3: 88,297,225 probably benign Het
Csmd3 T C 15: 47,888,684 T1293A possibly damaging Het
D10Jhu81e A G 10: 78,163,533 V148A probably damaging Het
Depdc1b A G 13: 108,384,820 D387G probably damaging Het
Dtx3l A G 16: 35,938,793 Y29H possibly damaging Het
Erp44 A T 4: 48,279,435 N2K probably benign Het
Fmn1 A G 2: 113,365,125 E390G unknown Het
Ganab T A 19: 8,910,591 D396E probably benign Het
Gcc2 T A 10: 58,286,160 S1140T probably damaging Het
Gm10499 G A 17: 36,143,339 noncoding transcript Het
Gm7008 T C 12: 40,223,343 probably benign Het
Gphn T A 12: 78,590,587 F354I probably damaging Het
Hnrnpul1 G A 7: 25,745,175 T236M probably damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
Jaml T A 9: 45,104,266 M356K probably damaging Het
Kbtbd12 T A 6: 88,617,699 probably benign Het
Ldlrad3 G T 2: 102,113,609 N39K probably damaging Het
Lrp1b G A 2: 41,110,840 T2238I possibly damaging Het
Lypd8 T A 11: 58,386,808 C139S possibly damaging Het
Masp1 G T 16: 23,494,695 H163Q probably damaging Het
Mpo T C 11: 87,796,457 probably benign Het
Muc19 A T 15: 91,928,025 noncoding transcript Het
Muc5ac T A 7: 141,793,971 S438T probably benign Het
Nav2 T C 7: 49,551,725 V160A probably benign Het
Nlrc5 G T 8: 94,494,316 A1128S probably benign Het
Nlrp5 T A 7: 23,417,976 L375Q probably damaging Het
Nlrp9a A G 7: 26,557,292 T112A probably benign Het
Nppa T C 4: 148,001,316 S127P probably damaging Het
Olfr1058 A G 2: 86,385,849 S190P possibly damaging Het
Osbpl1a T C 18: 12,933,696 N2S probably benign Het
Otoa A G 7: 121,139,793 T742A probably damaging Het
Pcdh10 A G 3: 45,392,814 R1015G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plpp1 T A 13: 112,851,512 Y56* probably null Het
Ppp1r12a A G 10: 108,261,025 T236A probably benign Het
Rhag T C 17: 40,828,504 L110P probably damaging Het
Sgms2 T A 3: 131,342,117 K36I probably damaging Het
Slc22a2 A G 17: 12,586,832 N157D probably damaging Het
Stx19 T G 16: 62,822,574 M251R probably benign Het
Suco A G 1: 161,834,705 I719T probably benign Het
Tnr A G 1: 159,923,315 D1282G probably damaging Het
Tram1 T C 1: 13,578,125 R154G probably benign Het
Ubtfl1 G T 9: 18,410,030 V285L probably benign Het
Ugt2b38 A G 5: 87,423,742 S144P probably benign Het
Washc2 T G 6: 116,209,004 *58G probably null Het
Zfp354a T A 11: 51,070,049 S362R probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAACCTGTTGGGCTTGG -3'
(R):5'- TTGACACTTTCTCGGGCAGC -3'

Sequencing Primer
(F):5'- GCTTGGCCACACGCAAC -3'
(R):5'- GATAACCACTTCAGCCGGCTG -3'
Posted On2016-07-22