Incidental Mutation 'R5224:Gcc2'
ID402507
Institutional Source Beutler Lab
Gene Symbol Gcc2
Ensembl Gene ENSMUSG00000038039
Gene NameGRIP and coiled-coil domain containing 2
Synonyms2600014C01Rik, 0610043A03Rik, 2210420P05Rik
MMRRC Submission 042797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R5224 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location58255497-58305599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58286160 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1140 (S1140T)
Ref Sequence ENSEMBL: ENSMUSP00000124152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160416] [ENSMUST00000162041] [ENSMUST00000162860]
Predicted Effect probably damaging
Transcript: ENSMUST00000057659
AA Change: S1240T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039
AA Change: S1240T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
coiled coil region 33 282 N/A INTRINSIC
internal_repeat_2 353 378 3.94e-5 PROSPERO
internal_repeat_2 382 406 3.94e-5 PROSPERO
coiled coil region 790 882 N/A INTRINSIC
low complexity region 939 964 N/A INTRINSIC
internal_repeat_1 1093 1111 1.93e-5 PROSPERO
low complexity region 1115 1132 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
coiled coil region 1441 1470 N/A INTRINSIC
internal_repeat_1 1554 1572 1.93e-5 PROSPERO
Grip 1608 1655 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160416
SMART Domains Protein: ENSMUSP00000123873
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 37 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160636
Predicted Effect probably damaging
Transcript: ENSMUST00000162041
AA Change: S1204T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039
AA Change: S1204T

DomainStartEndE-ValueType
coiled coil region 32 246 N/A INTRINSIC
internal_repeat_2 317 342 3.28e-5 PROSPERO
internal_repeat_2 346 370 3.28e-5 PROSPERO
coiled coil region 754 846 N/A INTRINSIC
low complexity region 903 928 N/A INTRINSIC
internal_repeat_1 1057 1075 1.6e-5 PROSPERO
low complexity region 1079 1096 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
coiled coil region 1405 1434 N/A INTRINSIC
internal_repeat_1 1518 1536 1.6e-5 PROSPERO
Grip 1572 1619 4.37e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162860
AA Change: S1140T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039
AA Change: S1140T

DomainStartEndE-ValueType
coiled coil region 46 182 N/A INTRINSIC
internal_repeat_2 253 278 4.17e-5 PROSPERO
internal_repeat_2 282 306 4.17e-5 PROSPERO
coiled coil region 690 782 N/A INTRINSIC
low complexity region 839 864 N/A INTRINSIC
internal_repeat_1 993 1011 2.06e-5 PROSPERO
low complexity region 1015 1032 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
coiled coil region 1341 1370 N/A INTRINSIC
internal_repeat_1 1450 1468 2.06e-5 PROSPERO
Grip 1504 1551 4.37e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,719,050 S1014R possibly damaging Het
Ahi1 A G 10: 20,987,022 S699G probably damaging Het
Atp10d C T 5: 72,269,326 A959V probably benign Het
Axl T C 7: 25,786,944 M112V probably benign Het
Btbd11 CGTGACCTTTCTGGT CGT 10: 85,645,522 probably benign Het
Camk1g A T 1: 193,355,034 D119E probably damaging Het
Capn8 A C 1: 182,596,989 N117T probably damaging Het
Cct3 G A 3: 88,297,225 probably benign Het
Csmd3 T C 15: 47,888,684 T1293A possibly damaging Het
D10Jhu81e A G 10: 78,163,533 V148A probably damaging Het
Depdc1b A G 13: 108,384,820 D387G probably damaging Het
Dtx3l A G 16: 35,938,793 Y29H possibly damaging Het
Erp44 A T 4: 48,279,435 N2K probably benign Het
Fmn1 A G 2: 113,365,125 E390G unknown Het
Ganab T A 19: 8,910,591 D396E probably benign Het
Gm10499 G A 17: 36,143,339 noncoding transcript Het
Gm7008 T C 12: 40,223,343 probably benign Het
Gphn T A 12: 78,590,587 F354I probably damaging Het
Hnrnpul1 G A 7: 25,745,175 T236M probably damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
Jaml T A 9: 45,104,266 M356K probably damaging Het
Kbtbd12 T A 6: 88,617,699 probably benign Het
Ldlrad3 G T 2: 102,113,609 N39K probably damaging Het
Lrp1b G A 2: 41,110,840 T2238I possibly damaging Het
Lypd8 T A 11: 58,386,808 C139S possibly damaging Het
Masp1 G T 16: 23,494,695 H163Q probably damaging Het
Mpo T C 11: 87,796,457 probably benign Het
Muc19 A T 15: 91,928,025 noncoding transcript Het
Muc5ac T A 7: 141,793,971 S438T probably benign Het
Nav2 T C 7: 49,551,725 V160A probably benign Het
Nlrc5 G T 8: 94,494,316 A1128S probably benign Het
Nlrp5 T A 7: 23,417,976 L375Q probably damaging Het
Nlrp9a A G 7: 26,557,292 T112A probably benign Het
Nppa T C 4: 148,001,316 S127P probably damaging Het
Olfr1058 A G 2: 86,385,849 S190P possibly damaging Het
Osbpl1a T C 18: 12,933,696 N2S probably benign Het
Otoa A G 7: 121,139,793 T742A probably damaging Het
Pcdh10 A G 3: 45,392,814 R1015G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plpp1 T A 13: 112,851,512 Y56* probably null Het
Ppp1r12a A G 10: 108,261,025 T236A probably benign Het
Rhag T C 17: 40,828,504 L110P probably damaging Het
Scn11a T A 9: 119,754,792 N1586Y probably damaging Het
Sgms2 T A 3: 131,342,117 K36I probably damaging Het
Slc22a2 A G 17: 12,586,832 N157D probably damaging Het
Stx19 T G 16: 62,822,574 M251R probably benign Het
Suco A G 1: 161,834,705 I719T probably benign Het
Tnr A G 1: 159,923,315 D1282G probably damaging Het
Tram1 T C 1: 13,578,125 R154G probably benign Het
Ubtfl1 G T 9: 18,410,030 V285L probably benign Het
Ugt2b38 A G 5: 87,423,742 S144P probably benign Het
Washc2 T G 6: 116,209,004 *58G probably null Het
Zfp354a T A 11: 51,070,049 S362R probably damaging Het
Other mutations in Gcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gcc2 APN 10 58292680 missense probably damaging 1.00
IGL00850:Gcc2 APN 10 58258248 missense probably benign 0.00
IGL00935:Gcc2 APN 10 58278779 splice site probably benign
IGL01551:Gcc2 APN 10 58298869 splice site probably benign
IGL01642:Gcc2 APN 10 58280612 missense probably benign 0.00
IGL02041:Gcc2 APN 10 58269281 missense probably damaging 1.00
IGL02215:Gcc2 APN 10 58271636 missense probably benign 0.36
IGL02448:Gcc2 APN 10 58292571 nonsense probably null
IGL02698:Gcc2 APN 10 58271290 missense possibly damaging 0.76
IGL02888:Gcc2 APN 10 58294828 missense probably damaging 1.00
IGL02936:Gcc2 APN 10 58296140 missense probably damaging 1.00
IGL03223:Gcc2 APN 10 58298734 missense probably damaging 1.00
IGL03249:Gcc2 APN 10 58270992 nonsense probably null
R0179:Gcc2 UTSW 10 58276650 missense probably benign 0.39
R0528:Gcc2 UTSW 10 58298689 missense probably damaging 1.00
R1569:Gcc2 UTSW 10 58270171 missense probably benign 0.00
R1606:Gcc2 UTSW 10 58269448 missense probably damaging 1.00
R1725:Gcc2 UTSW 10 58304115 missense possibly damaging 0.95
R1916:Gcc2 UTSW 10 58276663 missense probably damaging 1.00
R1956:Gcc2 UTSW 10 58286143 missense possibly damaging 0.66
R2058:Gcc2 UTSW 10 58285957 missense probably benign 0.10
R2114:Gcc2 UTSW 10 58269540 nonsense probably null
R2280:Gcc2 UTSW 10 58269680 missense probably benign 0.38
R2435:Gcc2 UTSW 10 58294780 missense probably damaging 1.00
R2876:Gcc2 UTSW 10 58290302 missense probably damaging 0.99
R4753:Gcc2 UTSW 10 58290382 missense probably benign 0.20
R4827:Gcc2 UTSW 10 58286131 critical splice acceptor site probably null
R4911:Gcc2 UTSW 10 58270439 missense probably damaging 1.00
R5033:Gcc2 UTSW 10 58278806 missense probably damaging 0.98
R5271:Gcc2 UTSW 10 58269695 missense possibly damaging 0.46
R5398:Gcc2 UTSW 10 58269507 missense probably benign 0.00
R5411:Gcc2 UTSW 10 58270969 missense probably damaging 0.99
R5594:Gcc2 UTSW 10 58287242 missense probably damaging 0.99
R5825:Gcc2 UTSW 10 58294821 missense probably damaging 1.00
R5974:Gcc2 UTSW 10 58258243 missense probably damaging 0.99
R5987:Gcc2 UTSW 10 58255847 utr 5 prime probably benign
R6195:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6198:Gcc2 UTSW 10 58292590 missense probably benign 0.26
R6233:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6331:Gcc2 UTSW 10 58271465 missense probably benign
R6349:Gcc2 UTSW 10 58269474 missense probably benign 0.01
R6593:Gcc2 UTSW 10 58271507 missense probably damaging 1.00
R6632:Gcc2 UTSW 10 58270049 unclassified probably null
R6647:Gcc2 UTSW 10 58287281 critical splice donor site probably null
R6774:Gcc2 UTSW 10 58281439 missense possibly damaging 0.94
R6808:Gcc2 UTSW 10 58258242 missense probably damaging 0.99
R7072:Gcc2 UTSW 10 58270927 missense probably benign 0.02
R7220:Gcc2 UTSW 10 58280594 missense probably benign 0.00
R7352:Gcc2 UTSW 10 58280698 critical splice donor site probably null
R7384:Gcc2 UTSW 10 58269964 missense probably damaging 1.00
R7439:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7441:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7543:Gcc2 UTSW 10 58271264 missense probably benign 0.02
X0018:Gcc2 UTSW 10 58278814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGCTGCTTGTGAAAACC -3'
(R):5'- CTTCAGCAAAGTACTGAGCATTCTTC -3'

Sequencing Primer
(F):5'- CAGCTGCTTGTGAAAACCAAAAAG -3'
(R):5'- CCTTAGGGGTCACCAGAAAGTATC -3'
Posted On2016-07-22