Mutagenetix > Incidental Mutations

Incidental Mutation 'R5224:Masp1'

402520

Institutional Source

Beutler Lab

Gene Symbol

Masp1

Ensembl Gene

ENSMUSG00000022887

Gene Name

mannan-binding lectin serine peptidase 1

Synonyms

Crarf

MMRRC Submission

042797-MU

Accession Numbers

Genbank: NM_008555; MGI: 88492

Is this an essential gene?

Probably non essential (E-score: 0.166) question?

Stock #

R5224 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23449417-23520815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 23494695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 163 (H163Q)

Ref Sequence

ENSEMBL: ENSMUSP00000155665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000229619] [ENSMUST00000230040]

AlphaFold

P98064

Predicted Effect

probably damaging
Transcript: ENSMUST00000089883
AA Change: H163Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: H163Q

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
CUB	23	143	2.96e-36	SMART
EGF_CA	144	187	1.46e-7	SMART
CUB	190	302	1.49e-41	SMART
CCP	306	367	4.41e-12	SMART
CCP	372	437	3.05e-6	SMART
Tryp_SPc	453	696	4.66e-84	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229152

Predicted Effect

probably damaging
Transcript: ENSMUST00000229619
AA Change: H163Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000230040
AA Change: H163Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.1319

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,719,050	S1014R	possibly damaging	Het
Ahi1	A	G	10: 20,987,022	S699G	probably damaging	Het
Atp10d	C	T	5: 72,269,326	A959V	probably benign	Het
Axl	T	C	7: 25,786,944	M112V	probably benign	Het
Btbd11	CGTGACCTTTCTGGT	CGT	10: 85,645,522		probably benign	Het
Camk1g	A	T	1: 193,355,034	D119E	probably damaging	Het
Capn8	A	C	1: 182,596,989	N117T	probably damaging	Het
Cct3	G	A	3: 88,297,225		probably benign	Het
Csmd3	T	C	15: 47,888,684	T1293A	possibly damaging	Het
D10Jhu81e	A	G	10: 78,163,533	V148A	probably damaging	Het
Depdc1b	A	G	13: 108,384,820	D387G	probably damaging	Het
Dtx3l	A	G	16: 35,938,793	Y29H	possibly damaging	Het
Erp44	A	T	4: 48,279,435	N2K	probably benign	Het
Fmn1	A	G	2: 113,365,125	E390G	unknown	Het
Ganab	T	A	19: 8,910,591	D396E	probably benign	Het
Gcc2	T	A	10: 58,286,160	S1140T	probably damaging	Het
Gm10499	G	A	17: 36,143,339		noncoding transcript	Het
Gm7008	T	C	12: 40,223,343		probably benign	Het
Gphn	T	A	12: 78,590,587	F354I	probably damaging	Het
Hnrnpul1	G	A	7: 25,745,175	T236M	probably damaging	Het
Itpr2	T	A	6: 146,166,651	M2410L	probably benign	Het
Jaml	T	A	9: 45,104,266	M356K	probably damaging	Het
Kbtbd12	T	A	6: 88,617,699		probably benign	Het
Ldlrad3	G	T	2: 102,113,609	N39K	probably damaging	Het
Lrp1b	G	A	2: 41,110,840	T2238I	possibly damaging	Het
Lypd8	T	A	11: 58,386,808	C139S	possibly damaging	Het
Mpo	T	C	11: 87,796,457		probably benign	Het
Muc19	A	T	15: 91,928,025		noncoding transcript	Het
Muc5ac	T	A	7: 141,793,971	S438T	probably benign	Het
Nav2	T	C	7: 49,551,725	V160A	probably benign	Het
Nlrc5	G	T	8: 94,494,316	A1128S	probably benign	Het
Nlrp5	T	A	7: 23,417,976	L375Q	probably damaging	Het
Nlrp9a	A	G	7: 26,557,292	T112A	probably benign	Het
Nppa	T	C	4: 148,001,316	S127P	probably damaging	Het
Olfr1058	A	G	2: 86,385,849	S190P	possibly damaging	Het
Osbpl1a	T	C	18: 12,933,696	N2S	probably benign	Het
Otoa	A	G	7: 121,139,793	T742A	probably damaging	Het
Pcdh10	A	G	3: 45,392,814	R1015G	probably damaging	Het
Pdzrn3	C	T	6: 101,153,311	D515N	probably damaging	Het
Plpp1	T	A	13: 112,851,512	Y56*	probably null	Het
Ppp1r12a	A	G	10: 108,261,025	T236A	probably benign	Het
Rhag	T	C	17: 40,828,504	L110P	probably damaging	Het
Scn11a	T	A	9: 119,754,792	N1586Y	probably damaging	Het
Sgms2	T	A	3: 131,342,117	K36I	probably damaging	Het
Slc22a2	A	G	17: 12,586,832	N157D	probably damaging	Het
Stx19	T	G	16: 62,822,574	M251R	probably benign	Het
Suco	A	G	1: 161,834,705	I719T	probably benign	Het
Tnr	A	G	1: 159,923,315	D1282G	probably damaging	Het
Tram1	T	C	1: 13,578,125	R154G	probably benign	Het
Ubtfl1	G	T	9: 18,410,030	V285L	probably benign	Het
Ugt2b38	A	G	5: 87,423,742	S144P	probably benign	Het
Washc2	T	G	6: 116,209,004	*58G	probably null	Het
Zfp354a	T	A	11: 51,070,049	S362R	probably damaging	Het

Other mutations in Masp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Masp1	APN	16	23458091	missense	possibly damaging	0.93
IGL00428:Masp1	APN	16	23476312	missense	probably damaging	1.00
IGL00432:Masp1	APN	16	23513851	missense	probably damaging	1.00
IGL02598:Masp1	APN	16	23459631	missense	probably benign
IGL02718:Masp1	APN	16	23476293	missense	probably damaging	1.00
IGL02947:Masp1	APN	16	23494726	missense	probably damaging	0.99
A4554:Masp1	UTSW	16	23454940	splice site	probably null
PIT1430001:Masp1	UTSW	16	23513944	missense	probably damaging	1.00
R0103:Masp1	UTSW	16	23458018	missense	probably damaging	1.00
R0505:Masp1	UTSW	16	23458138	missense	probably benign
R0630:Masp1	UTSW	16	23452419	missense	probably benign	0.01
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1339:Masp1	UTSW	16	23452467	missense	probably damaging	1.00
R1521:Masp1	UTSW	16	23494637	missense	probably damaging	1.00
R1588:Masp1	UTSW	16	23494654	missense	probably damaging	1.00
R1961:Masp1	UTSW	16	23452932	missense	probably damaging	1.00
R1986:Masp1	UTSW	16	23483461	missense	probably benign	0.01
R2080:Masp1	UTSW	16	23491959	missense	probably damaging	1.00
R2215:Masp1	UTSW	16	23452521	missense	possibly damaging	0.92
R2216:Masp1	UTSW	16	23492055	missense	probably benign	0.00
R2443:Masp1	UTSW	16	23476312	missense	probably damaging	1.00
R4934:Masp1	UTSW	16	23465076	missense	probably damaging	0.98
R5340:Masp1	UTSW	16	23458108	missense	probably damaging	1.00
R5562:Masp1	UTSW	16	23465167	splice site	probably null
R5663:Masp1	UTSW	16	23452938	missense	possibly damaging	0.57
R5742:Masp1	UTSW	16	23454925	missense	probably benign	0.01
R5763:Masp1	UTSW	16	23496247	missense	probably damaging	1.00
R5898:Masp1	UTSW	16	23491927	missense	probably damaging	0.99
R6901:Masp1	UTSW	16	23513834	missense	probably damaging	0.99
R6987:Masp1	UTSW	16	23513915	missense	probably damaging	1.00
R7069:Masp1	UTSW	16	23452455	missense	probably benign	0.20
R7356:Masp1	UTSW	16	23470243	missense	possibly damaging	0.50
R7512:Masp1	UTSW	16	23470124	missense	probably damaging	1.00
R7539:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R7810:Masp1	UTSW	16	23476318	missense	probably benign	0.01
R8026:Masp1	UTSW	16	23484406	missense	probably damaging	1.00
R8391:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R8438:Masp1	UTSW	16	23470403	missense	probably benign	0.38
R8475:Masp1	UTSW	16	23452531	missense	probably damaging	0.99
R8870:Masp1	UTSW	16	23496132	missense	probably damaging	1.00
R9052:Masp1	UTSW	16	23520600	start gained	probably benign
R9072:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9073:Masp1	UTSW	16	23469921	missense	probably benign	0.07
X0065:Masp1	UTSW	16	23513969	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGTACATACCTGACATTTGATAC -3'
(R):5'- CAAGATGTGGTGATTACTTCTACC -3'

Sequencing Primer
(F):5'- AGCAAGGCCTTTCTACAGTG -3'
(R):5'- CCAAGACTCATATTGGCAAGGTTC -3'

Posted On

2016-07-22