Incidental Mutation 'R5225:Slc24a5'
ID402538
Institutional Source Beutler Lab
Gene Symbol Slc24a5
Ensembl Gene ENSMUSG00000035183
Gene Namesolute carrier family 24, member 5
SynonymsOca6, NCX5, F630045L20Rik, NCKX5
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125068124-125088677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125085819 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 346 (I346T)
Ref Sequence ENSEMBL: ENSMUSP00000063887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067780] [ENSMUST00000070353] [ENSMUST00000110501] [ENSMUST00000142718] [ENSMUST00000147105] [ENSMUST00000152367]
Predicted Effect probably benign
Transcript: ENSMUST00000067780
SMART Domains Protein: ENSMUSP00000066312
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000070353
AA Change: I346T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063887
Gene: ENSMUSG00000035183
AA Change: I346T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Na_Ca_ex 72 216 1.1e-24 PFAM
low complexity region 274 290 N/A INTRINSIC
low complexity region 311 324 N/A INTRINSIC
Pfam:Na_Ca_ex 334 485 7.6e-31 PFAM
low complexity region 488 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089825
SMART Domains Protein: ENSMUSP00000087258
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 48 121 1.84e-22 SMART
low complexity region 154 167 N/A INTRINSIC
RRM 181 253 5.12e-21 SMART
low complexity region 274 291 N/A INTRINSIC
low complexity region 386 406 N/A INTRINSIC
RRM 454 525 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110501
SMART Domains Protein: ENSMUSP00000106127
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139615
Predicted Effect probably benign
Transcript: ENSMUST00000142718
SMART Domains Protein: ENSMUSP00000115519
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
RRM 491 562 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147105
SMART Domains Protein: ENSMUSP00000114817
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
RRM 474 545 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149963
Predicted Effect probably benign
Transcript: ENSMUST00000152367
SMART Domains Protein: ENSMUSP00000123088
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
RRM 515 586 6.15e-24 SMART
Meta Mutation Damage Score 0.8206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the potassium-dependent sodium/calcium exchanger family and encodes an intracellular membrane protein with 2 large hydrophilic loops and 2 sets of multiple transmembrane-spanning segments. Sequence variation in this gene has been associated with differences in skin pigmentation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypopigmentation and ocular albinism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Slc24a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Slc24a5 APN 2 125080889 missense probably damaging 1.00
IGL01307:Slc24a5 APN 2 125080880 missense probably damaging 1.00
IGL01926:Slc24a5 APN 2 125068903 missense probably benign 0.01
IGL02090:Slc24a5 APN 2 125068298 missense probably benign 0.25
IGL02313:Slc24a5 APN 2 125085647 unclassified probably benign
IGL02328:Slc24a5 APN 2 125080639 missense probably damaging 1.00
IGL02743:Slc24a5 APN 2 125088234 missense probably damaging 1.00
IGL02969:Slc24a5 APN 2 125083227 missense probably damaging 1.00
IGL03212:Slc24a5 APN 2 125080830 missense probably damaging 1.00
IGL03258:Slc24a5 APN 2 125080705 critical splice donor site probably null
R0344:Slc24a5 UTSW 2 125085701 missense probably benign 0.03
R0811:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R0812:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R1018:Slc24a5 UTSW 2 125068907 missense probably damaging 1.00
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1753:Slc24a5 UTSW 2 125083195 missense possibly damaging 0.53
R2147:Slc24a5 UTSW 2 125087441 missense probably damaging 1.00
R4934:Slc24a5 UTSW 2 125088020 missense probably damaging 1.00
R4964:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R4966:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R5275:Slc24a5 UTSW 2 125085861 missense probably benign 0.09
R5438:Slc24a5 UTSW 2 125068865 missense probably damaging 1.00
R5866:Slc24a5 UTSW 2 125085671 missense probably damaging 1.00
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6114:Slc24a5 UTSW 2 125083092 missense probably benign 0.01
R6211:Slc24a5 UTSW 2 125088251 missense probably benign 0.23
R6516:Slc24a5 UTSW 2 125088107 missense probably benign 0.01
R6675:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6677:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6826:Slc24a5 UTSW 2 125068858 missense probably benign 0.00
R7100:Slc24a5 UTSW 2 125080671 missense probably damaging 1.00
R7122:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
R7381:Slc24a5 UTSW 2 125068949 missense probably benign 0.29
R7398:Slc24a5 UTSW 2 125085774 nonsense probably null
R7401:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
R8219:Slc24a5 UTSW 2 125085655 critical splice acceptor site probably null
X0067:Slc24a5 UTSW 2 125087503 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAATGTTGAACTTTCCCACCACAG -3'
(R):5'- AAAACATGAATGAGCTTGCTGG -3'

Sequencing Primer
(F):5'- CAGATCCACCAAGTGTTTTCAGCATG -3'
(R):5'- AAACATGAATGAGCTTGCTGGTTTTG -3'
Posted On2016-07-22