Incidental Mutation 'R5225:Abcg3'
ID 402547
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission 042798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R5225 (G1)
Quality Score 217
Status Validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105114649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 289 (D289E)
Ref Sequence ENSEMBL: ENSMUSP00000120179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably damaging
Transcript: ENSMUST00000031239
AA Change: D289E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: D289E

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130644
AA Change: D289E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: D289E

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197004
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,226,839 (GRCm39) R465* probably null Het
Ablim2 G T 5: 36,024,115 (GRCm39) probably null Het
Acp1 A T 12: 30,955,078 (GRCm39) V36D probably benign Het
Adgrb1 T A 15: 74,449,348 (GRCm39) probably benign Het
Akap6 G A 12: 52,933,329 (GRCm39) V274I probably damaging Het
Arhgap39 T C 15: 76,609,715 (GRCm39) probably benign Het
Bmp1 G A 14: 70,717,605 (GRCm39) R789W probably damaging Het
Catspere2 A T 1: 177,976,474 (GRCm39) probably benign Het
Cfhr2 T A 1: 139,749,520 (GRCm39) Y154F possibly damaging Het
Cilp2 T C 8: 70,336,015 (GRCm39) Y358C probably damaging Het
Cyp1a2 T A 9: 57,584,516 (GRCm39) K513* probably null Het
Dennd4a G T 9: 64,796,210 (GRCm39) K745N possibly damaging Het
Dlg1 T A 16: 31,655,085 (GRCm39) S542T probably benign Het
Dmbt1 A T 7: 130,696,465 (GRCm39) I893F possibly damaging Het
Dnhd1 A T 7: 105,353,130 (GRCm39) E2761V possibly damaging Het
F11 T C 8: 45,708,341 (GRCm39) T40A probably benign Het
Fam227a T C 15: 79,520,936 (GRCm39) D296G possibly damaging Het
Fance C T 17: 28,534,589 (GRCm39) probably benign Het
Gaa A G 11: 119,167,669 (GRCm39) D149G probably damaging Het
Gapt A G 13: 110,490,522 (GRCm39) M47T possibly damaging Het
Gm1110 T C 9: 26,813,774 (GRCm39) N202D probably damaging Het
Gm7535 T C 17: 18,131,809 (GRCm39) probably benign Het
Gm973 T A 1: 59,601,859 (GRCm39) M491K probably benign Het
Gmnc A G 16: 26,782,695 (GRCm39) V27A probably benign Het
Kif27 T C 13: 58,440,915 (GRCm39) T1167A possibly damaging Het
Klrg1 T A 6: 122,248,331 (GRCm39) *189C probably null Het
Lime1 T A 2: 181,024,640 (GRCm39) M98K probably benign Het
Lrp1 C A 10: 127,391,965 (GRCm39) A2867S probably benign Het
Lrrd1 G A 5: 3,908,735 (GRCm39) S669N probably benign Het
Mmel1 A G 4: 154,976,456 (GRCm39) N520S probably damaging Het
Mrpl48 A C 7: 100,198,535 (GRCm39) L206V probably damaging Het
Nagpa C T 16: 5,021,596 (GRCm39) A52T probably benign Het
Or1o3 A G 17: 37,573,919 (GRCm39) V212A probably benign Het
Or4c3 T G 2: 89,851,528 (GRCm39) D294A probably benign Het
Orai2 A G 5: 136,190,355 (GRCm39) S71P probably damaging Het
Pcbp1 A T 6: 86,502,209 (GRCm39) I230N probably damaging Het
Pcdh15 T C 10: 74,138,986 (GRCm39) L349P probably damaging Het
Pcdhb16 T C 18: 37,613,011 (GRCm39) V657A probably benign Het
Prdm15 G T 16: 97,609,875 (GRCm39) H590N probably damaging Het
Psg18 T C 7: 18,079,874 (GRCm39) I442M probably damaging Het
Pygm C A 19: 6,439,494 (GRCm39) D279E probably benign Het
Rrn3 T A 16: 13,610,798 (GRCm39) probably null Het
Sass6 T C 3: 116,407,702 (GRCm39) S273P possibly damaging Het
Schip1 A G 3: 68,402,270 (GRCm39) M116V probably benign Het
Sdc3 G A 4: 130,546,087 (GRCm39) V55I unknown Het
Serpinb8 T A 1: 107,525,201 (GRCm39) M1K probably null Het
Slc24a5 T C 2: 124,927,739 (GRCm39) I346T probably damaging Het
Slc35f3 T A 8: 127,117,846 (GRCm39) I335N probably damaging Het
Snapc2 T A 8: 4,305,299 (GRCm39) V147E probably damaging Het
Snx2 T C 18: 53,322,784 (GRCm39) S56P possibly damaging Het
Sptbn5 A G 2: 119,915,812 (GRCm39) probably benign Het
Stk19 A T 17: 35,040,400 (GRCm39) probably benign Het
Sulf1 A G 1: 12,911,702 (GRCm39) E692G probably benign Het
Tet1 C T 10: 62,674,450 (GRCm39) V1209I probably damaging Het
Tln1 T C 4: 43,539,406 (GRCm39) T1639A probably benign Het
Tmem135 G T 7: 88,845,335 (GRCm39) Y165* probably null Het
Tmprss6 T C 15: 78,336,707 (GRCm39) T398A probably damaging Het
Ube4a C T 9: 44,851,258 (GRCm39) probably null Het
Vmn1r227 T C 17: 20,955,499 (GRCm39) noncoding transcript Het
Wdhd1 T C 14: 47,488,273 (GRCm39) S745G probably benign Het
Xylt1 A G 7: 117,191,263 (GRCm39) H353R probably damaging Het
Zfp788 A G 7: 41,298,980 (GRCm39) T539A probably benign Het
Zfp866 A T 8: 70,218,091 (GRCm39) F510I possibly damaging Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATAAGCACCCGGAACTG -3'
(R):5'- AATTTGGGCTGAGTTCAAGTGC -3'

Sequencing Primer
(F):5'- ACAAAGTCTACCAGCTAATTTTAGG -3'
(R):5'- GGCCTGCATTCTTTGTAG -3'
Posted On 2016-07-22