Incidental Mutation 'R5225:Mrpl48'
ID402554
Institutional Source Beutler Lab
Gene Symbol Mrpl48
Ensembl Gene ENSMUSG00000030706
Gene Namemitochondrial ribosomal protein L48
SynonymsCGI-118, 1810030E20Rik, D4Ertd786e
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100545751-100608301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 100549328 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 206 (L206V)
Ref Sequence ENSEMBL: ENSMUSP00000116090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064334] [ENSMUST00000107053] [ENSMUST00000132888] [ENSMUST00000137777] [ENSMUST00000138448] [ENSMUST00000146003] [ENSMUST00000150042]
Predicted Effect probably benign
Transcript: ENSMUST00000064334
SMART Domains Protein: ENSMUSP00000067290
Gene: ENSMUSG00000030706

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 71 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107053
Predicted Effect probably benign
Transcript: ENSMUST00000132888
Predicted Effect probably benign
Transcript: ENSMUST00000137777
Predicted Effect probably benign
Transcript: ENSMUST00000138448
Predicted Effect possibly damaging
Transcript: ENSMUST00000146003
AA Change: L108V

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000150042
AA Change: L206V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116090
Gene: ENSMUSG00000030706
AA Change: L206V

DomainStartEndE-ValueType
low complexity region 62 74 N/A INTRINSIC
Pfam:Ribosomal_S10 91 186 2.6e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 6p. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Mrpl48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Mrpl48 APN 7 100550532 splice site probably benign
IGL01838:Mrpl48 APN 7 100552653 missense probably damaging 1.00
IGL02395:Mrpl48 APN 7 100546344 utr 3 prime probably benign
IGL02878:Mrpl48 APN 7 100574513 missense possibly damaging 0.92
R0195:Mrpl48 UTSW 7 100546353 utr 3 prime probably benign
R1498:Mrpl48 UTSW 7 100546488 utr 3 prime probably benign
R1619:Mrpl48 UTSW 7 100546275 utr 3 prime probably benign
R2058:Mrpl48 UTSW 7 100549333 missense probably damaging 1.00
R2059:Mrpl48 UTSW 7 100549333 missense probably damaging 1.00
R2279:Mrpl48 UTSW 7 100565264 missense probably damaging 1.00
R3952:Mrpl48 UTSW 7 100559923 splice site probably benign
R4682:Mrpl48 UTSW 7 100549369 missense probably damaging 0.96
R4887:Mrpl48 UTSW 7 100546409 utr 3 prime probably benign
R5278:Mrpl48 UTSW 7 100552583 missense probably damaging 1.00
R5405:Mrpl48 UTSW 7 100559793 missense probably damaging 1.00
R6209:Mrpl48 UTSW 7 100559794 missense probably damaging 1.00
R6809:Mrpl48 UTSW 7 100546367 utr 3 prime probably benign
R7666:Mrpl48 UTSW 7 100565201 missense probably benign
R8518:Mrpl48 UTSW 7 100583062 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGACATTTATTAGGTGGAGAAGGTC -3'
(R):5'- TTCCTGGTACCCGATTCAGG -3'

Sequencing Primer
(F):5'- AAGGTCCTAGGTTTTGTTATGGGAAG -3'
(R):5'- TGCTACATACTACAAGGGCTGACTG -3'
Posted On2016-07-22