Incidental Mutation 'R5225:Dnhd1'
ID 402555
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Name dynein heavy chain domain 1
Synonyms 8030491N06Rik
MMRRC Submission 042798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R5225 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105300034-105371006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105353130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 2761 (E2761V)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145988]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000145988
AA Change: E2761V

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: E2761V

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,226,839 (GRCm39) R465* probably null Het
Abcg3 A T 5: 105,114,649 (GRCm39) D289E probably damaging Het
Ablim2 G T 5: 36,024,115 (GRCm39) probably null Het
Acp1 A T 12: 30,955,078 (GRCm39) V36D probably benign Het
Adgrb1 T A 15: 74,449,348 (GRCm39) probably benign Het
Akap6 G A 12: 52,933,329 (GRCm39) V274I probably damaging Het
Arhgap39 T C 15: 76,609,715 (GRCm39) probably benign Het
Bmp1 G A 14: 70,717,605 (GRCm39) R789W probably damaging Het
Catspere2 A T 1: 177,976,474 (GRCm39) probably benign Het
Cfhr2 T A 1: 139,749,520 (GRCm39) Y154F possibly damaging Het
Cilp2 T C 8: 70,336,015 (GRCm39) Y358C probably damaging Het
Cyp1a2 T A 9: 57,584,516 (GRCm39) K513* probably null Het
Dennd4a G T 9: 64,796,210 (GRCm39) K745N possibly damaging Het
Dlg1 T A 16: 31,655,085 (GRCm39) S542T probably benign Het
Dmbt1 A T 7: 130,696,465 (GRCm39) I893F possibly damaging Het
F11 T C 8: 45,708,341 (GRCm39) T40A probably benign Het
Fam227a T C 15: 79,520,936 (GRCm39) D296G possibly damaging Het
Fance C T 17: 28,534,589 (GRCm39) probably benign Het
Gaa A G 11: 119,167,669 (GRCm39) D149G probably damaging Het
Gapt A G 13: 110,490,522 (GRCm39) M47T possibly damaging Het
Gm1110 T C 9: 26,813,774 (GRCm39) N202D probably damaging Het
Gm7535 T C 17: 18,131,809 (GRCm39) probably benign Het
Gm973 T A 1: 59,601,859 (GRCm39) M491K probably benign Het
Gmnc A G 16: 26,782,695 (GRCm39) V27A probably benign Het
Kif27 T C 13: 58,440,915 (GRCm39) T1167A possibly damaging Het
Klrg1 T A 6: 122,248,331 (GRCm39) *189C probably null Het
Lime1 T A 2: 181,024,640 (GRCm39) M98K probably benign Het
Lrp1 C A 10: 127,391,965 (GRCm39) A2867S probably benign Het
Lrrd1 G A 5: 3,908,735 (GRCm39) S669N probably benign Het
Mmel1 A G 4: 154,976,456 (GRCm39) N520S probably damaging Het
Mrpl48 A C 7: 100,198,535 (GRCm39) L206V probably damaging Het
Nagpa C T 16: 5,021,596 (GRCm39) A52T probably benign Het
Or1o3 A G 17: 37,573,919 (GRCm39) V212A probably benign Het
Or4c3 T G 2: 89,851,528 (GRCm39) D294A probably benign Het
Orai2 A G 5: 136,190,355 (GRCm39) S71P probably damaging Het
Pcbp1 A T 6: 86,502,209 (GRCm39) I230N probably damaging Het
Pcdh15 T C 10: 74,138,986 (GRCm39) L349P probably damaging Het
Pcdhb16 T C 18: 37,613,011 (GRCm39) V657A probably benign Het
Prdm15 G T 16: 97,609,875 (GRCm39) H590N probably damaging Het
Psg18 T C 7: 18,079,874 (GRCm39) I442M probably damaging Het
Pygm C A 19: 6,439,494 (GRCm39) D279E probably benign Het
Rrn3 T A 16: 13,610,798 (GRCm39) probably null Het
Sass6 T C 3: 116,407,702 (GRCm39) S273P possibly damaging Het
Schip1 A G 3: 68,402,270 (GRCm39) M116V probably benign Het
Sdc3 G A 4: 130,546,087 (GRCm39) V55I unknown Het
Serpinb8 T A 1: 107,525,201 (GRCm39) M1K probably null Het
Slc24a5 T C 2: 124,927,739 (GRCm39) I346T probably damaging Het
Slc35f3 T A 8: 127,117,846 (GRCm39) I335N probably damaging Het
Snapc2 T A 8: 4,305,299 (GRCm39) V147E probably damaging Het
Snx2 T C 18: 53,322,784 (GRCm39) S56P possibly damaging Het
Sptbn5 A G 2: 119,915,812 (GRCm39) probably benign Het
Stk19 A T 17: 35,040,400 (GRCm39) probably benign Het
Sulf1 A G 1: 12,911,702 (GRCm39) E692G probably benign Het
Tet1 C T 10: 62,674,450 (GRCm39) V1209I probably damaging Het
Tln1 T C 4: 43,539,406 (GRCm39) T1639A probably benign Het
Tmem135 G T 7: 88,845,335 (GRCm39) Y165* probably null Het
Tmprss6 T C 15: 78,336,707 (GRCm39) T398A probably damaging Het
Ube4a C T 9: 44,851,258 (GRCm39) probably null Het
Vmn1r227 T C 17: 20,955,499 (GRCm39) noncoding transcript Het
Wdhd1 T C 14: 47,488,273 (GRCm39) S745G probably benign Het
Xylt1 A G 7: 117,191,263 (GRCm39) H353R probably damaging Het
Zfp788 A G 7: 41,298,980 (GRCm39) T539A probably benign Het
Zfp866 A T 8: 70,218,091 (GRCm39) F510I possibly damaging Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105,327,202 (GRCm39) missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105,306,418 (GRCm39) missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105,341,882 (GRCm39) missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105,370,895 (GRCm39) missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105,363,116 (GRCm39) missense probably benign
IGL01714:Dnhd1 APN 7 105,370,149 (GRCm39) missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105,362,961 (GRCm39) missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105,301,237 (GRCm39) missense probably benign
IGL01999:Dnhd1 APN 7 105,370,422 (GRCm39) missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105,327,516 (GRCm39) missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105,370,009 (GRCm39) missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105,370,951 (GRCm39) missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105,370,688 (GRCm39) missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105,369,948 (GRCm39) missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105,369,089 (GRCm39) missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105,363,682 (GRCm39) missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105,362,940 (GRCm39) missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105,304,930 (GRCm39) missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105,370,131 (GRCm39) missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105,369,321 (GRCm39) missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105,343,602 (GRCm39) missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105,363,252 (GRCm39) missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105,344,958 (GRCm39) missense probably benign
R0669:Dnhd1 UTSW 7 105,342,911 (GRCm39) missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105,301,113 (GRCm39) missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105,358,378 (GRCm39) missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105,362,238 (GRCm39) missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105,346,106 (GRCm39) missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105,343,360 (GRCm39) missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105,369,331 (GRCm39) missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105,370,480 (GRCm39) critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105,317,670 (GRCm39) missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105,342,867 (GRCm39) missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105,353,355 (GRCm39) missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105,362,913 (GRCm39) missense possibly damaging 0.74
R1615:Dnhd1 UTSW 7 105,352,413 (GRCm39) missense probably benign 0.00
R1656:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105,343,035 (GRCm39) missense probably benign
R1723:Dnhd1 UTSW 7 105,364,127 (GRCm39) missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105,343,179 (GRCm39) missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105,304,974 (GRCm39) missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105,353,412 (GRCm39) missense probably benign
R1920:Dnhd1 UTSW 7 105,362,614 (GRCm39) missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105,323,061 (GRCm39) missense probably damaging 0.96
R1925:Dnhd1 UTSW 7 105,301,459 (GRCm39) missense probably damaging 1.00
R1934:Dnhd1 UTSW 7 105,357,789 (GRCm39) missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105,354,128 (GRCm39) missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105,327,178 (GRCm39) missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105,342,928 (GRCm39) missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105,352,979 (GRCm39) missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105,354,606 (GRCm39) missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105,323,628 (GRCm39) missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105,359,297 (GRCm39) missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105,352,674 (GRCm39) missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105,342,871 (GRCm39) missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105,369,438 (GRCm39) missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105,361,766 (GRCm39) missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105,369,436 (GRCm39) missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105,345,772 (GRCm39) critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3405:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3439:Dnhd1 UTSW 7 105,343,992 (GRCm39) missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105,362,329 (GRCm39) missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105,364,045 (GRCm39) missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105,358,795 (GRCm39) missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105,362,205 (GRCm39) missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105,345,935 (GRCm39) nonsense probably null
R4565:Dnhd1 UTSW 7 105,301,163 (GRCm39) missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105,306,373 (GRCm39) splice site probably null
R4584:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105,363,237 (GRCm39) missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105,364,653 (GRCm39) missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105,352,851 (GRCm39) missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105,304,948 (GRCm39) missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105,370,324 (GRCm39) missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105,353,171 (GRCm39) missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105,364,015 (GRCm39) missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105,306,164 (GRCm39) missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105,362,840 (GRCm39) missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105,362,283 (GRCm39) missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105,342,904 (GRCm39) missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105,362,647 (GRCm39) missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105,363,759 (GRCm39) missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105,345,667 (GRCm39) missense probably benign 0.00
R5250:Dnhd1 UTSW 7 105,334,968 (GRCm39) missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5258:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5273:Dnhd1 UTSW 7 105,363,689 (GRCm39) missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105,363,644 (GRCm39) missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105,362,891 (GRCm39) missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105,363,363 (GRCm39) missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105,364,028 (GRCm39) missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105,323,395 (GRCm39) missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105,354,217 (GRCm39) missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105,304,981 (GRCm39) missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105,369,102 (GRCm39) missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105,369,388 (GRCm39) missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105,344,955 (GRCm39) missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105,369,711 (GRCm39) missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105,363,194 (GRCm39) missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105,358,647 (GRCm39) missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105,353,255 (GRCm39) missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105,301,216 (GRCm39) missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105,342,577 (GRCm39) missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105,343,273 (GRCm39) missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105,327,093 (GRCm39) missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105,353,006 (GRCm39) missense probably benign
R6663:Dnhd1 UTSW 7 105,334,899 (GRCm39) splice site probably null
R6730:Dnhd1 UTSW 7 105,353,082 (GRCm39) missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105,369,844 (GRCm39) missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105,352,580 (GRCm39) missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105,369,137 (GRCm39) missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105,352,935 (GRCm39) missense probably benign
R6860:Dnhd1 UTSW 7 105,327,473 (GRCm39) missense probably benign
R6898:Dnhd1 UTSW 7 105,336,584 (GRCm39) missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105,364,770 (GRCm39) missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105,362,895 (GRCm39) missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105,353,792 (GRCm39) missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105,363,417 (GRCm39) missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105,370,005 (GRCm39) missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105,344,161 (GRCm39) missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105,364,468 (GRCm39) missense probably benign 0.26
R7086:Dnhd1 UTSW 7 105,357,739 (GRCm39) missense probably benign 0.03
R7112:Dnhd1 UTSW 7 105,363,192 (GRCm39) missense probably damaging 1.00
R7140:Dnhd1 UTSW 7 105,342,973 (GRCm39) missense probably benign 0.00
R7151:Dnhd1 UTSW 7 105,359,234 (GRCm39) missense probably benign 0.03
R7178:Dnhd1 UTSW 7 105,344,200 (GRCm39) missense probably damaging 0.98
R7326:Dnhd1 UTSW 7 105,370,137 (GRCm39) missense probably damaging 0.96
R7345:Dnhd1 UTSW 7 105,353,174 (GRCm39) missense probably benign 0.17
R7349:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R7397:Dnhd1 UTSW 7 105,354,504 (GRCm39) missense possibly damaging 0.87
R7520:Dnhd1 UTSW 7 105,345,255 (GRCm39) missense probably benign 0.07
R7536:Dnhd1 UTSW 7 105,358,768 (GRCm39) missense probably damaging 1.00
R7539:Dnhd1 UTSW 7 105,370,119 (GRCm39) missense probably damaging 1.00
R7541:Dnhd1 UTSW 7 105,327,516 (GRCm39) missense probably damaging 1.00
R7619:Dnhd1 UTSW 7 105,323,475 (GRCm39) missense probably benign 0.01
R7676:Dnhd1 UTSW 7 105,333,294 (GRCm39) missense probably benign 0.09
R7689:Dnhd1 UTSW 7 105,363,170 (GRCm39) missense probably benign 0.07
R7712:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R7729:Dnhd1 UTSW 7 105,354,472 (GRCm39) missense probably damaging 1.00
R7767:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R7768:Dnhd1 UTSW 7 105,370,302 (GRCm39) missense possibly damaging 0.87
R7779:Dnhd1 UTSW 7 105,327,122 (GRCm39) missense probably benign 0.01
R7879:Dnhd1 UTSW 7 105,352,646 (GRCm39) missense probably benign 0.09
R7922:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 1.00
R7951:Dnhd1 UTSW 7 105,327,211 (GRCm39) missense probably damaging 1.00
R8259:Dnhd1 UTSW 7 105,343,995 (GRCm39) missense probably benign 0.38
R8350:Dnhd1 UTSW 7 105,327,231 (GRCm39) missense probably damaging 0.99
R8380:Dnhd1 UTSW 7 105,327,073 (GRCm39) missense probably benign 0.31
R8392:Dnhd1 UTSW 7 105,352,550 (GRCm39) missense possibly damaging 0.84
R8478:Dnhd1 UTSW 7 105,332,001 (GRCm39) missense probably benign 0.00
R8708:Dnhd1 UTSW 7 105,343,487 (GRCm39) nonsense probably null
R8767:Dnhd1 UTSW 7 105,301,330 (GRCm39) missense probably damaging 1.00
R8825:Dnhd1 UTSW 7 105,343,174 (GRCm39) missense possibly damaging 0.95
R8849:Dnhd1 UTSW 7 105,370,723 (GRCm39) missense probably benign 0.00
R8903:Dnhd1 UTSW 7 105,362,855 (GRCm39) nonsense probably null
R8910:Dnhd1 UTSW 7 105,332,904 (GRCm39) missense possibly damaging 0.92
R8940:Dnhd1 UTSW 7 105,363,854 (GRCm39) intron probably benign
R8954:Dnhd1 UTSW 7 105,343,986 (GRCm39) missense probably benign 0.35
R8956:Dnhd1 UTSW 7 105,341,852 (GRCm39) missense probably damaging 0.99
R8971:Dnhd1 UTSW 7 105,358,528 (GRCm39) nonsense probably null
R8996:Dnhd1 UTSW 7 105,323,242 (GRCm39) missense probably damaging 1.00
R9051:Dnhd1 UTSW 7 105,341,933 (GRCm39) missense possibly damaging 0.54
R9058:Dnhd1 UTSW 7 105,333,270 (GRCm39) missense probably benign 0.01
R9109:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9284:Dnhd1 UTSW 7 105,301,091 (GRCm39) missense probably damaging 1.00
R9295:Dnhd1 UTSW 7 105,363,348 (GRCm39) missense probably benign
R9298:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9299:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9308:Dnhd1 UTSW 7 105,353,484 (GRCm39) missense probably damaging 1.00
R9337:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9385:Dnhd1 UTSW 7 105,361,972 (GRCm39) missense probably damaging 1.00
R9463:Dnhd1 UTSW 7 105,344,223 (GRCm39) missense probably benign
R9463:Dnhd1 UTSW 7 105,306,454 (GRCm39) missense probably benign 0.00
R9476:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9489:Dnhd1 UTSW 7 105,300,804 (GRCm39) missense probably benign
R9500:Dnhd1 UTSW 7 105,353,709 (GRCm39) missense probably benign
R9510:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9513:Dnhd1 UTSW 7 105,354,179 (GRCm39) missense probably damaging 1.00
R9537:Dnhd1 UTSW 7 105,344,740 (GRCm39) missense probably damaging 0.99
R9567:Dnhd1 UTSW 7 105,353,473 (GRCm39) missense probably benign 0.03
R9622:Dnhd1 UTSW 7 105,353,342 (GRCm39) missense probably benign
R9623:Dnhd1 UTSW 7 105,344,134 (GRCm39) missense probably damaging 1.00
R9623:Dnhd1 UTSW 7 105,335,773 (GRCm39) missense probably damaging 1.00
R9674:Dnhd1 UTSW 7 105,363,429 (GRCm39) missense probably damaging 1.00
R9756:Dnhd1 UTSW 7 105,353,135 (GRCm39) missense probably benign 0.19
R9777:Dnhd1 UTSW 7 105,369,456 (GRCm39) missense probably benign 0.14
R9778:Dnhd1 UTSW 7 105,353,240 (GRCm39) missense probably benign
R9781:Dnhd1 UTSW 7 105,352,917 (GRCm39) missense probably benign 0.31
R9796:Dnhd1 UTSW 7 105,342,537 (GRCm39) missense probably damaging 1.00
Z1088:Dnhd1 UTSW 7 105,361,934 (GRCm39) missense probably benign 0.00
Z1176:Dnhd1 UTSW 7 105,352,243 (GRCm39) critical splice acceptor site probably null
Z1176:Dnhd1 UTSW 7 105,327,506 (GRCm39) missense probably benign
Z1176:Dnhd1 UTSW 7 105,317,754 (GRCm39) missense probably damaging 0.98
Z1176:Dnhd1 UTSW 7 105,352,787 (GRCm39) frame shift probably null
Z1177:Dnhd1 UTSW 7 105,332,048 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTTCCCATTGTGCTAAGCTGC -3'
(R):5'- AGTGTAAGCTCCAGACTGAAC -3'

Sequencing Primer
(F):5'- CCATTGTGCTAAGCTGCTTCTAGAAG -3'
(R):5'- CTGAACACCAGGTCTGAGG -3'
Posted On 2016-07-22