Mutagenetix > Incidental Mutation

Incidental Mutation 'R5225:Acp1'

402571

Institutional Source

Beutler Lab

Gene Symbol

Acp1

Ensembl Gene

ENSMUSG00000044573

Gene Name

acid phosphatase 1, soluble

Synonyms

Acp-1, LMW-PTP, 4632432E04Rik, Lmptp

MMRRC Submission

042798-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R5225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30943325-30961588 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30955078 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 36 (V36D)

Ref Sequence

ENSEMBL: ENSMUSP00000151833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062740] [ENSMUST00000074038] [ENSMUST00000219697]

AlphaFold

Q9D358

Predicted Effect

probably benign
Transcript: ENSMUST00000062740
AA Change: V36D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000106509
Gene: ENSMUSG00000044573
AA Change: V36D

Domain	Start	End	E-Value	Type
LMWPc	7	156	1.58e-68	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000074038
AA Change: V36D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000073686
Gene: ENSMUSG00000044573
AA Change: V36D

Domain	Start	End	E-Value	Type
LMWPc	7	156	5.62e-74	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218696

Predicted Effect

probably benign
Transcript: ENSMUST00000219697
AA Change: V36D

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222791

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele show an increased mean serum IL-6 response to LPS challenge. Male homozygotes are smaller than controls whereas female homozygotes show an increased mean skin fibroblast proliferation rate. Males homozygous for a different null allele show decreased response of heart to induced stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	C	T	17: 9,226,839 (GRCm39)	R465*	probably null	Het
Abcg3	A	T	5: 105,114,649 (GRCm39)	D289E	probably damaging	Het
Ablim2	G	T	5: 36,024,115 (GRCm39)		probably null	Het
Adgrb1	T	A	15: 74,449,348 (GRCm39)		probably benign	Het
Akap6	G	A	12: 52,933,329 (GRCm39)	V274I	probably damaging	Het
Arhgap39	T	C	15: 76,609,715 (GRCm39)		probably benign	Het
Bmp1	G	A	14: 70,717,605 (GRCm39)	R789W	probably damaging	Het
Catspere2	A	T	1: 177,976,474 (GRCm39)		probably benign	Het
Cfhr2	T	A	1: 139,749,520 (GRCm39)	Y154F	possibly damaging	Het
Cilp2	T	C	8: 70,336,015 (GRCm39)	Y358C	probably damaging	Het
Cyp1a2	T	A	9: 57,584,516 (GRCm39)	K513*	probably null	Het
Dennd4a	G	T	9: 64,796,210 (GRCm39)	K745N	possibly damaging	Het
Dlg1	T	A	16: 31,655,085 (GRCm39)	S542T	probably benign	Het
Dmbt1	A	T	7: 130,696,465 (GRCm39)	I893F	possibly damaging	Het
Dnhd1	A	T	7: 105,353,130 (GRCm39)	E2761V	possibly damaging	Het
F11	T	C	8: 45,708,341 (GRCm39)	T40A	probably benign	Het
Fam227a	T	C	15: 79,520,936 (GRCm39)	D296G	possibly damaging	Het
Fance	C	T	17: 28,534,589 (GRCm39)		probably benign	Het
Gaa	A	G	11: 119,167,669 (GRCm39)	D149G	probably damaging	Het
Gapt	A	G	13: 110,490,522 (GRCm39)	M47T	possibly damaging	Het
Gm1110	T	C	9: 26,813,774 (GRCm39)	N202D	probably damaging	Het
Gm7535	T	C	17: 18,131,809 (GRCm39)		probably benign	Het
Gm973	T	A	1: 59,601,859 (GRCm39)	M491K	probably benign	Het
Gmnc	A	G	16: 26,782,695 (GRCm39)	V27A	probably benign	Het
Kif27	T	C	13: 58,440,915 (GRCm39)	T1167A	possibly damaging	Het
Klrg1	T	A	6: 122,248,331 (GRCm39)	*189C	probably null	Het
Lime1	T	A	2: 181,024,640 (GRCm39)	M98K	probably benign	Het
Lrp1	C	A	10: 127,391,965 (GRCm39)	A2867S	probably benign	Het
Lrrd1	G	A	5: 3,908,735 (GRCm39)	S669N	probably benign	Het
Mmel1	A	G	4: 154,976,456 (GRCm39)	N520S	probably damaging	Het
Mrpl48	A	C	7: 100,198,535 (GRCm39)	L206V	probably damaging	Het
Nagpa	C	T	16: 5,021,596 (GRCm39)	A52T	probably benign	Het
Or1o3	A	G	17: 37,573,919 (GRCm39)	V212A	probably benign	Het
Or4c3	T	G	2: 89,851,528 (GRCm39)	D294A	probably benign	Het
Orai2	A	G	5: 136,190,355 (GRCm39)	S71P	probably damaging	Het
Pcbp1	A	T	6: 86,502,209 (GRCm39)	I230N	probably damaging	Het
Pcdh15	T	C	10: 74,138,986 (GRCm39)	L349P	probably damaging	Het
Pcdhb16	T	C	18: 37,613,011 (GRCm39)	V657A	probably benign	Het
Prdm15	G	T	16: 97,609,875 (GRCm39)	H590N	probably damaging	Het
Psg18	T	C	7: 18,079,874 (GRCm39)	I442M	probably damaging	Het
Pygm	C	A	19: 6,439,494 (GRCm39)	D279E	probably benign	Het
Rrn3	T	A	16: 13,610,798 (GRCm39)		probably null	Het
Sass6	T	C	3: 116,407,702 (GRCm39)	S273P	possibly damaging	Het
Schip1	A	G	3: 68,402,270 (GRCm39)	M116V	probably benign	Het
Sdc3	G	A	4: 130,546,087 (GRCm39)	V55I	unknown	Het
Serpinb8	T	A	1: 107,525,201 (GRCm39)	M1K	probably null	Het
Slc24a5	T	C	2: 124,927,739 (GRCm39)	I346T	probably damaging	Het
Slc35f3	T	A	8: 127,117,846 (GRCm39)	I335N	probably damaging	Het
Snapc2	T	A	8: 4,305,299 (GRCm39)	V147E	probably damaging	Het
Snx2	T	C	18: 53,322,784 (GRCm39)	S56P	possibly damaging	Het
Sptbn5	A	G	2: 119,915,812 (GRCm39)		probably benign	Het
Stk19	A	T	17: 35,040,400 (GRCm39)		probably benign	Het
Sulf1	A	G	1: 12,911,702 (GRCm39)	E692G	probably benign	Het
Tet1	C	T	10: 62,674,450 (GRCm39)	V1209I	probably damaging	Het
Tln1	T	C	4: 43,539,406 (GRCm39)	T1639A	probably benign	Het
Tmem135	G	T	7: 88,845,335 (GRCm39)	Y165*	probably null	Het
Tmprss6	T	C	15: 78,336,707 (GRCm39)	T398A	probably damaging	Het
Ube4a	C	T	9: 44,851,258 (GRCm39)		probably null	Het
Vmn1r227	T	C	17: 20,955,499 (GRCm39)		noncoding transcript	Het
Wdhd1	T	C	14: 47,488,273 (GRCm39)	S745G	probably benign	Het
Xylt1	A	G	7: 117,191,263 (GRCm39)	H353R	probably damaging	Het
Zfp788	A	G	7: 41,298,980 (GRCm39)	T539A	probably benign	Het
Zfp866	A	T	8: 70,218,091 (GRCm39)	F510I	possibly damaging	Het

Other mutations in Acp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Acp1	APN	12	30,947,792 (GRCm39)	missense	probably damaging	1.00
IGL00929:Acp1	APN	12	30,954,899 (GRCm39)	missense	probably damaging	1.00
IGL01982:Acp1	APN	12	30,961,491 (GRCm39)	missense	possibly damaging	0.77
IGL03012:Acp1	APN	12	30,945,948 (GRCm39)	missense	probably benign	0.08
R0918:Acp1	UTSW	12	30,955,126 (GRCm39)	nonsense	probably null
R1433:Acp1	UTSW	12	30,945,934 (GRCm39)	missense	possibly damaging	0.75
R1797:Acp1	UTSW	12	30,946,113 (GRCm39)	critical splice donor site	probably null
R1854:Acp1	UTSW	12	30,947,804 (GRCm39)	missense	possibly damaging	0.68
R4843:Acp1	UTSW	12	30,946,144 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCAAGCTCCAGTACGGTAC -3'
(R):5'- GGCATCCACTTTGGGAGTAG -3'

Sequencing Primer
(F):5'- TACCTGCCGTGCAATGTG -3'
(R):5'- ATCCACTTTGGGAGTAGTCCAC -3'

Posted On

2016-07-22