Incidental Mutation 'R5225:Tmprss6'
ID 402580
Institutional Source Beutler Lab
Gene Symbol Tmprss6
Ensembl Gene ENSMUSG00000016942
Gene Name transmembrane serine protease 6
Synonyms matriptase-2, 1300008A22Rik
MMRRC Submission 042798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R5225 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 78323867-78352834 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78336707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 398 (T398A)
Ref Sequence ENSEMBL: ENSMUSP00000155549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017086] [ENSMUST00000229124] [ENSMUST00000229516] [ENSMUST00000230159] [ENSMUST00000230226]
AlphaFold Q9DBI0
Predicted Effect probably benign
Transcript: ENSMUST00000017086
AA Change: T398A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942
AA Change: T398A

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229124
Predicted Effect probably benign
Transcript: ENSMUST00000229516
AA Change: T398A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000230159
AA Change: T398A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230226
AA Change: T386A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
Meta Mutation Damage Score 0.1468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(6) Gene trapped(2) Chemically induced(3)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,226,839 (GRCm39) R465* probably null Het
Abcg3 A T 5: 105,114,649 (GRCm39) D289E probably damaging Het
Ablim2 G T 5: 36,024,115 (GRCm39) probably null Het
Acp1 A T 12: 30,955,078 (GRCm39) V36D probably benign Het
Adgrb1 T A 15: 74,449,348 (GRCm39) probably benign Het
Akap6 G A 12: 52,933,329 (GRCm39) V274I probably damaging Het
Arhgap39 T C 15: 76,609,715 (GRCm39) probably benign Het
Bmp1 G A 14: 70,717,605 (GRCm39) R789W probably damaging Het
Catspere2 A T 1: 177,976,474 (GRCm39) probably benign Het
Cfhr2 T A 1: 139,749,520 (GRCm39) Y154F possibly damaging Het
Cilp2 T C 8: 70,336,015 (GRCm39) Y358C probably damaging Het
Cyp1a2 T A 9: 57,584,516 (GRCm39) K513* probably null Het
Dennd4a G T 9: 64,796,210 (GRCm39) K745N possibly damaging Het
Dlg1 T A 16: 31,655,085 (GRCm39) S542T probably benign Het
Dmbt1 A T 7: 130,696,465 (GRCm39) I893F possibly damaging Het
Dnhd1 A T 7: 105,353,130 (GRCm39) E2761V possibly damaging Het
F11 T C 8: 45,708,341 (GRCm39) T40A probably benign Het
Fam227a T C 15: 79,520,936 (GRCm39) D296G possibly damaging Het
Fance C T 17: 28,534,589 (GRCm39) probably benign Het
Gaa A G 11: 119,167,669 (GRCm39) D149G probably damaging Het
Gapt A G 13: 110,490,522 (GRCm39) M47T possibly damaging Het
Gm1110 T C 9: 26,813,774 (GRCm39) N202D probably damaging Het
Gm7535 T C 17: 18,131,809 (GRCm39) probably benign Het
Gm973 T A 1: 59,601,859 (GRCm39) M491K probably benign Het
Gmnc A G 16: 26,782,695 (GRCm39) V27A probably benign Het
Kif27 T C 13: 58,440,915 (GRCm39) T1167A possibly damaging Het
Klrg1 T A 6: 122,248,331 (GRCm39) *189C probably null Het
Lime1 T A 2: 181,024,640 (GRCm39) M98K probably benign Het
Lrp1 C A 10: 127,391,965 (GRCm39) A2867S probably benign Het
Lrrd1 G A 5: 3,908,735 (GRCm39) S669N probably benign Het
Mmel1 A G 4: 154,976,456 (GRCm39) N520S probably damaging Het
Mrpl48 A C 7: 100,198,535 (GRCm39) L206V probably damaging Het
Nagpa C T 16: 5,021,596 (GRCm39) A52T probably benign Het
Or1o3 A G 17: 37,573,919 (GRCm39) V212A probably benign Het
Or4c3 T G 2: 89,851,528 (GRCm39) D294A probably benign Het
Orai2 A G 5: 136,190,355 (GRCm39) S71P probably damaging Het
Pcbp1 A T 6: 86,502,209 (GRCm39) I230N probably damaging Het
Pcdh15 T C 10: 74,138,986 (GRCm39) L349P probably damaging Het
Pcdhb16 T C 18: 37,613,011 (GRCm39) V657A probably benign Het
Prdm15 G T 16: 97,609,875 (GRCm39) H590N probably damaging Het
Psg18 T C 7: 18,079,874 (GRCm39) I442M probably damaging Het
Pygm C A 19: 6,439,494 (GRCm39) D279E probably benign Het
Rrn3 T A 16: 13,610,798 (GRCm39) probably null Het
Sass6 T C 3: 116,407,702 (GRCm39) S273P possibly damaging Het
Schip1 A G 3: 68,402,270 (GRCm39) M116V probably benign Het
Sdc3 G A 4: 130,546,087 (GRCm39) V55I unknown Het
Serpinb8 T A 1: 107,525,201 (GRCm39) M1K probably null Het
Slc24a5 T C 2: 124,927,739 (GRCm39) I346T probably damaging Het
Slc35f3 T A 8: 127,117,846 (GRCm39) I335N probably damaging Het
Snapc2 T A 8: 4,305,299 (GRCm39) V147E probably damaging Het
Snx2 T C 18: 53,322,784 (GRCm39) S56P possibly damaging Het
Sptbn5 A G 2: 119,915,812 (GRCm39) probably benign Het
Stk19 A T 17: 35,040,400 (GRCm39) probably benign Het
Sulf1 A G 1: 12,911,702 (GRCm39) E692G probably benign Het
Tet1 C T 10: 62,674,450 (GRCm39) V1209I probably damaging Het
Tln1 T C 4: 43,539,406 (GRCm39) T1639A probably benign Het
Tmem135 G T 7: 88,845,335 (GRCm39) Y165* probably null Het
Ube4a C T 9: 44,851,258 (GRCm39) probably null Het
Vmn1r227 T C 17: 20,955,499 (GRCm39) noncoding transcript Het
Wdhd1 T C 14: 47,488,273 (GRCm39) S745G probably benign Het
Xylt1 A G 7: 117,191,263 (GRCm39) H353R probably damaging Het
Zfp788 A G 7: 41,298,980 (GRCm39) T539A probably benign Het
Zfp866 A T 8: 70,218,091 (GRCm39) F510I possibly damaging Het
Other mutations in Tmprss6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tmprss6 APN 15 78,326,634 (GRCm39) missense probably null 1.00
IGL02474:Tmprss6 APN 15 78,326,536 (GRCm39) missense probably damaging 0.99
cubone UTSW 15 78,330,857 (GRCm39) splice site probably null
dilutional UTSW 15 78,328,328 (GRCm39) missense probably damaging 1.00
Ekans UTSW 15 78,343,627 (GRCm39) splice site probably null
mask UTSW 15 78,464,455 (GRCm38) intron probably benign
masquerade UTSW 15 78,352,200 (GRCm39) intron probably benign
zorro UTSW 15 78,464,552 (GRCm38) intron probably benign
BB003:Tmprss6 UTSW 15 78,337,050 (GRCm39) missense probably benign 0.28
BB013:Tmprss6 UTSW 15 78,337,050 (GRCm39) missense probably benign 0.28
PIT1430001:Tmprss6 UTSW 15 78,324,827 (GRCm39) missense probably damaging 1.00
R0285:Tmprss6 UTSW 15 78,337,068 (GRCm39) missense probably damaging 0.99
R1857:Tmprss6 UTSW 15 78,336,752 (GRCm39) missense probably damaging 1.00
R2432:Tmprss6 UTSW 15 78,349,304 (GRCm39) splice site probably benign
R4192:Tmprss6 UTSW 15 78,330,857 (GRCm39) splice site probably null
R4226:Tmprss6 UTSW 15 78,330,899 (GRCm39) missense probably damaging 1.00
R4227:Tmprss6 UTSW 15 78,330,899 (GRCm39) missense probably damaging 1.00
R4334:Tmprss6 UTSW 15 78,343,627 (GRCm39) splice site probably null
R4344:Tmprss6 UTSW 15 78,343,627 (GRCm39) splice site probably null
R4446:Tmprss6 UTSW 15 78,337,039 (GRCm39) missense probably damaging 1.00
R4508:Tmprss6 UTSW 15 78,343,978 (GRCm39) missense probably damaging 1.00
R4643:Tmprss6 UTSW 15 78,329,556 (GRCm39) missense probably damaging 0.98
R4743:Tmprss6 UTSW 15 78,327,910 (GRCm39) missense probably damaging 0.99
R4836:Tmprss6 UTSW 15 78,329,588 (GRCm39) missense probably damaging 1.00
R4859:Tmprss6 UTSW 15 78,330,877 (GRCm39) missense probably damaging 0.99
R4869:Tmprss6 UTSW 15 78,327,880 (GRCm39) splice site probably null
R5197:Tmprss6 UTSW 15 78,338,389 (GRCm39) missense probably damaging 1.00
R5212:Tmprss6 UTSW 15 78,330,460 (GRCm39) missense probably damaging 0.99
R5569:Tmprss6 UTSW 15 78,324,503 (GRCm39) missense probably damaging 1.00
R5572:Tmprss6 UTSW 15 78,326,622 (GRCm39) missense probably damaging 1.00
R5669:Tmprss6 UTSW 15 78,339,156 (GRCm39) missense possibly damaging 0.86
R5947:Tmprss6 UTSW 15 78,336,722 (GRCm39) missense probably damaging 1.00
R6800:Tmprss6 UTSW 15 78,324,457 (GRCm39) missense probably damaging 1.00
R6941:Tmprss6 UTSW 15 78,330,977 (GRCm39) missense probably damaging 1.00
R6965:Tmprss6 UTSW 15 78,328,328 (GRCm39) missense probably damaging 1.00
R7334:Tmprss6 UTSW 15 78,328,017 (GRCm39) missense unknown
R7338:Tmprss6 UTSW 15 78,344,019 (GRCm39) missense probably damaging 1.00
R7622:Tmprss6 UTSW 15 78,330,926 (GRCm39) missense probably benign 0.40
R7926:Tmprss6 UTSW 15 78,337,050 (GRCm39) missense probably benign 0.28
R7992:Tmprss6 UTSW 15 78,326,664 (GRCm39) missense probably benign 0.11
R8177:Tmprss6 UTSW 15 78,349,327 (GRCm39) missense probably benign 0.01
R8792:Tmprss6 UTSW 15 78,328,328 (GRCm39) missense probably damaging 1.00
R8881:Tmprss6 UTSW 15 78,327,987 (GRCm39) makesense probably null
R9084:Tmprss6 UTSW 15 78,338,417 (GRCm39) missense probably damaging 0.98
R9384:Tmprss6 UTSW 15 78,328,302 (GRCm39) missense probably damaging 0.99
X0025:Tmprss6 UTSW 15 78,339,295 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TATCTGGGGAAAGGCTGGTC -3'
(R):5'- AATCCTTAGGGCTTCAGGGAC -3'

Sequencing Primer
(F):5'- TCAGGACAGGAGGGACAGTC -3'
(R):5'- TGGCCCAAGTACTCACAGG -3'
Posted On 2016-07-22