Incidental Mutation 'R5225:Rrn3'
ID402583
Institutional Source Beutler Lab
Gene Symbol Rrn3
Ensembl Gene ENSMUSG00000022682
Gene NameRRN3 RNA polymerase I transcription factor homolog (yeast)
SynonymsTIF-1A, E130302O19Rik
MMRRC Submission 042798-MU
Accession Numbers

Genbank: NM_001039521; MGI: 1925255

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13780708-13814839 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 13792934 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023363]
Predicted Effect probably null
Transcript: ENSMUST00000023363
SMART Domains Protein: ENSMUSP00000023363
Gene: ENSMUSG00000022682

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:RRN3 46 584 7.5e-138 PFAM
low complexity region 597 605 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure to undergo embryonic turning, delayed embryonic development, markedly reduced embryo size, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(36)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Rrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Rrn3 APN 16 13809062 missense probably damaging 1.00
IGL02507:Rrn3 APN 16 13788857 missense probably benign
IGL02607:Rrn3 APN 16 13806563 missense possibly damaging 0.65
IGL02648:Rrn3 APN 16 13811589 missense probably benign
IGL03217:Rrn3 APN 16 13809011 missense possibly damaging 0.83
IGL03403:Rrn3 APN 16 13799945 nonsense probably null
11287:Rrn3 UTSW 16 13800019 splice site probably null
ANU74:Rrn3 UTSW 16 13811533 missense possibly damaging 0.65
R0013:Rrn3 UTSW 16 13813113 missense possibly damaging 0.92
R0013:Rrn3 UTSW 16 13813113 missense possibly damaging 0.92
R0308:Rrn3 UTSW 16 13799882 splice site probably benign
R1970:Rrn3 UTSW 16 13789074 missense probably damaging 1.00
R3712:Rrn3 UTSW 16 13784095 nonsense probably null
R3959:Rrn3 UTSW 16 13782100 critical splice donor site probably null
R4343:Rrn3 UTSW 16 13784122 missense probably benign 0.01
R4678:Rrn3 UTSW 16 13796076 missense probably damaging 1.00
R4920:Rrn3 UTSW 16 13790639 missense probably benign 0.01
R4925:Rrn3 UTSW 16 13799972 missense probably damaging 1.00
R5469:Rrn3 UTSW 16 13813100 missense probably benign 0.01
R5702:Rrn3 UTSW 16 13813266 nonsense probably null
R6059:Rrn3 UTSW 16 13806604 missense probably benign
R6425:Rrn3 UTSW 16 13811601 missense probably benign 0.00
R7582:Rrn3 UTSW 16 13810511 nonsense probably null
R7814:Rrn3 UTSW 16 13811589 missense probably benign
Z1176:Rrn3 UTSW 16 13813156 missense probably damaging 1.00
Z1177:Rrn3 UTSW 16 13788846 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGTGTGTTACTAAGGAGAAATGC -3'
(R):5'- AGGCCAAGTTCTAAAAGTATGACG -3'

Sequencing Primer
(F):5'- TGTTACTAAGGAGAAATGCTGGTG -3'
(R):5'- GAAGCAAAGATCTGGACTGTTCTCC -3'
Posted On2016-07-22