Incidental Mutation 'R5225:Pcdhb16'
ID402592
Institutional Source Beutler Lab
Gene Symbol Pcdhb16
Ensembl Gene ENSMUSG00000047910
Gene Nameprotocadherin beta 16
SynonymsPcdhb8, PcdhbP
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37477814-37483038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37479958 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 657 (V657A)
Ref Sequence ENSEMBL: ENSMUSP00000056347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000053856] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000050034
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
AA Change: V657A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910
AA Change: V657A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Pcdhb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pcdhb16 APN 18 37478570 missense possibly damaging 0.95
IGL00540:Pcdhb16 APN 18 37479798 missense probably damaging 1.00
IGL01380:Pcdhb16 APN 18 37479445 missense probably benign 0.30
IGL02043:Pcdhb16 APN 18 37479195 missense probably benign 0.05
IGL02103:Pcdhb16 APN 18 37480108 missense probably benign 0.19
IGL02151:Pcdhb16 APN 18 37478358 missense possibly damaging 0.80
IGL02619:Pcdhb16 APN 18 37478217 nonsense probably null
IGL02832:Pcdhb16 APN 18 37478474 missense probably damaging 1.00
IGL03190:Pcdhb16 APN 18 37479343 missense probably damaging 1.00
IGL03274:Pcdhb16 APN 18 37479232 missense probably benign 0.04
IGL03292:Pcdhb16 APN 18 37480384 missense probably damaging 0.99
BB008:Pcdhb16 UTSW 18 37478457 missense possibly damaging 0.90
BB018:Pcdhb16 UTSW 18 37478457 missense possibly damaging 0.90
R0076:Pcdhb16 UTSW 18 37478359 missense probably damaging 1.00
R0423:Pcdhb16 UTSW 18 37480369 missense probably benign 0.00
R1191:Pcdhb16 UTSW 18 37479873 missense probably damaging 1.00
R1254:Pcdhb16 UTSW 18 37479295 missense possibly damaging 0.67
R1417:Pcdhb16 UTSW 18 37478127 missense probably benign 0.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1517:Pcdhb16 UTSW 18 37478098 missense probably benign 0.03
R1645:Pcdhb16 UTSW 18 37479370 missense probably benign 0.05
R1706:Pcdhb16 UTSW 18 37479652 missense probably benign 0.26
R1770:Pcdhb16 UTSW 18 37479180 missense probably damaging 1.00
R1809:Pcdhb16 UTSW 18 37478388 missense probably damaging 0.99
R1946:Pcdhb16 UTSW 18 37478899 nonsense probably null
R1967:Pcdhb16 UTSW 18 37479662 missense probably damaging 1.00
R2008:Pcdhb16 UTSW 18 37478263 missense probably damaging 1.00
R2220:Pcdhb16 UTSW 18 37478967 missense probably benign 0.16
R2432:Pcdhb16 UTSW 18 37479930 missense probably damaging 0.98
R3121:Pcdhb16 UTSW 18 37478218 missense possibly damaging 0.55
R3692:Pcdhb16 UTSW 18 37478287 missense probably benign 0.28
R3766:Pcdhb16 UTSW 18 37478196 nonsense probably null
R3891:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R3892:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R4551:Pcdhb16 UTSW 18 37479834 missense probably damaging 1.00
R4614:Pcdhb16 UTSW 18 37480345 missense probably benign 0.22
R4716:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R4908:Pcdhb16 UTSW 18 37479841 splice site probably null
R5185:Pcdhb16 UTSW 18 37480089 missense possibly damaging 0.96
R5422:Pcdhb16 UTSW 18 37479867 missense probably damaging 1.00
R5939:Pcdhb16 UTSW 18 37478064 missense probably benign
R6149:Pcdhb16 UTSW 18 37479155 missense possibly damaging 0.95
R6647:Pcdhb16 UTSW 18 37479172 missense possibly damaging 0.57
R7080:Pcdhb16 UTSW 18 37478463 nonsense probably null
R7354:Pcdhb16 UTSW 18 37478124 missense possibly damaging 0.79
R7413:Pcdhb16 UTSW 18 37478922 nonsense probably null
R7459:Pcdhb16 UTSW 18 37479553 missense probably benign 0.26
R7655:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7656:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7827:Pcdhb16 UTSW 18 37478851 missense possibly damaging 0.95
R7921:Pcdhb16 UTSW 18 37478245 missense probably damaging 1.00
R7931:Pcdhb16 UTSW 18 37478457 missense possibly damaging 0.90
R8133:Pcdhb16 UTSW 18 37478132 missense probably damaging 0.99
Z1176:Pcdhb16 UTSW 18 37479160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGCCTGGCTGTCGTTC -3'
(R):5'- TTGGTAGCTCTGAGACAGGGTC -3'

Sequencing Primer
(F):5'- GTCGTTCCAGCTGCTCAAAG -3'
(R):5'- GAAAGTGTCCCTCAGGCACAG -3'
Posted On2016-07-22