Mutagenetix > Incidental Mutations

Incidental Mutation 'R5225:Snx2'

402593

Institutional Source

Beutler Lab

Gene Symbol

Snx2

Ensembl Gene

ENSMUSG00000034484

Gene Name

sorting nexin 2

Synonyms

0610030A03Rik

MMRRC Submission

042798-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53176365-53220860 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53189712 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 56 (S56P)

Ref Sequence

ENSEMBL: ENSMUSP00000039243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037850]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037850
AA Change: S56P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039243
Gene: ENSMUSG00000034484
AA Change: S56P

Domain	Start	End	E-Value	Type
Pfam:Sorting_nexin	2	134	1.6e-29	PFAM
PX	138	265	1.4e-38	SMART
Pfam:Vps5	281	514	2.2e-90	PFAM

Meta Mutation Damage Score

0.2078

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the sorting nexin family whose members contain the phosphoinositide-binding phox (PX) domain. The encoded protein is a component of the retromer complex which plays a role in protein sorting in the endocytic pathway. This protein may form oligomeric complexes with other family members. Alternate splicing results in multiple transcript variants of this gene. Pseudogenes associated with this gene are located on chromosomes 1 and 7. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	C	T	17: 9,008,007	R465*	probably null	Het
Abcg3	A	T	5: 104,966,783	D289E	probably damaging	Het
Ablim2	G	T	5: 35,866,771		probably null	Het
Acp1	A	T	12: 30,905,079	V36D	probably benign	Het
Adgrb1	T	A	15: 74,577,499		probably benign	Het
Akap6	G	A	12: 52,886,546	V274I	probably damaging	Het
Arhgap39	T	C	15: 76,725,515		probably benign	Het
Bmp1	G	A	14: 70,480,165	R789W	probably damaging	Het
Cfhr2	T	A	1: 139,821,782	Y154F	possibly damaging	Het
Cilp2	T	C	8: 69,883,365	Y358C	probably damaging	Het
Cyp1a2	T	A	9: 57,677,233	K513*	probably null	Het
Dennd4a	G	T	9: 64,888,928	K745N	possibly damaging	Het
Dlg1	T	A	16: 31,836,267	S542T	probably benign	Het
Dmbt1	A	T	7: 131,094,735	I893F	possibly damaging	Het
Dnhd1	A	T	7: 105,703,923	E2761V	possibly damaging	Het
F11	T	C	8: 45,255,304	T40A	probably benign	Het
Fam227a	T	C	15: 79,636,735	D296G	possibly damaging	Het
Fance	C	T	17: 28,315,615		probably benign	Het
Gaa	A	G	11: 119,276,843	D149G	probably damaging	Het
Gapt	A	G	13: 110,353,988	M47T	possibly damaging	Het
Gm1110	T	C	9: 26,902,478	N202D	probably damaging	Het
Gm16432	A	T	1: 178,148,908		probably benign	Het
Gm7535	T	C	17: 17,911,547		probably benign	Het
Gm973	T	A	1: 59,562,700	M491K	probably benign	Het
Gmnc	A	G	16: 26,963,945	V27A	probably benign	Het
Kif27	T	C	13: 58,293,101	T1167A	possibly damaging	Het
Klrg1	T	A	6: 122,271,372	*189C	probably null	Het
Lime1	T	A	2: 181,382,847	M98K	probably benign	Het
Lrp1	C	A	10: 127,556,096	A2867S	probably benign	Het
Lrrd1	G	A	5: 3,858,735	S669N	probably benign	Het
Mmel1	A	G	4: 154,891,999	N520S	probably damaging	Het
Mrpl48	A	C	7: 100,549,328	L206V	probably damaging	Het
Nagpa	C	T	16: 5,203,732	A52T	probably benign	Het
Olfr1264	T	G	2: 90,021,184	D294A	probably benign	Het
Olfr98	A	G	17: 37,263,028	V212A	probably benign	Het
Orai2	A	G	5: 136,161,501	S71P	probably damaging	Het
Pcbp1	A	T	6: 86,525,227	I230N	probably damaging	Het
Pcdh15	T	C	10: 74,303,154	L349P	probably damaging	Het
Pcdhb16	T	C	18: 37,479,958	V657A	probably benign	Het
Prdm15	G	T	16: 97,808,675	H590N	probably damaging	Het
Psg18	T	C	7: 18,345,949	I442M	probably damaging	Het
Pygm	C	A	19: 6,389,464	D279E	probably benign	Het
Rrn3	T	A	16: 13,792,934		probably null	Het
Sass6	T	C	3: 116,614,053	S273P	possibly damaging	Het
Schip1	A	G	3: 68,494,937	M116V	probably benign	Het
Sdc3	G	A	4: 130,818,776	V55I	unknown	Het
Serpinb8	T	A	1: 107,597,471	M1K	probably null	Het
Slc24a5	T	C	2: 125,085,819	I346T	probably damaging	Het
Slc35f3	T	A	8: 126,391,107	I335N	probably damaging	Het
Snapc2	T	A	8: 4,255,299	V147E	probably damaging	Het
Sptbn5	A	G	2: 120,085,331		probably benign	Het
Stk19	A	T	17: 34,821,424		probably benign	Het
Sulf1	A	G	1: 12,841,478	E692G	probably benign	Het
Tet1	C	T	10: 62,838,671	V1209I	probably damaging	Het
Tln1	T	C	4: 43,539,406	T1639A	probably benign	Het
Tmem135	G	T	7: 89,196,127	Y165*	probably null	Het
Tmprss6	T	C	15: 78,452,507	T398A	probably damaging	Het
Ube4a	C	T	9: 44,939,960		probably null	Het
Vmn1r227	T	C	17: 20,735,237		noncoding transcript	Het
Wdhd1	T	C	14: 47,250,816	S745G	probably benign	Het
Xylt1	A	G	7: 117,592,036	H353R	probably damaging	Het
Zfp788	A	G	7: 41,649,556	T539A	probably benign	Het
Zfp866	A	T	8: 69,765,441	F510I	possibly damaging	Het

Other mutations in Snx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Snx2	APN	18	53216400	missense	possibly damaging	0.95
IGL00861:Snx2	APN	18	53210797	splice site	probably null
IGL01116:Snx2	APN	18	53194423	splice site	probably benign
IGL01642:Snx2	APN	18	53216447	missense	probably damaging	0.99
IGL02178:Snx2	APN	18	53199785	missense	possibly damaging	0.61
IGL02368:Snx2	APN	18	53189721	missense	probably benign
IGL02597:Snx2	APN	18	53210372	missense	probably benign	0.09
IGL02964:Snx2	APN	18	53194558	missense	probably benign	0.00
IGL03372:Snx2	APN	18	53216391	missense	probably damaging	1.00
blanched	UTSW	18	53194444	missense	probably damaging	0.98
bleached	UTSW	18	53197925	splice site	probably null
R0332:Snx2	UTSW	18	53212911	missense	probably benign	0.01
R0723:Snx2	UTSW	18	53210372	missense	probably benign	0.09
R0746:Snx2	UTSW	18	53197889	missense	possibly damaging	0.90
R0826:Snx2	UTSW	18	53194522	missense	probably benign	0.00
R0894:Snx2	UTSW	18	53176416	missense	probably benign
R0970:Snx2	UTSW	18	53210690	splice site	probably benign
R1897:Snx2	UTSW	18	53197878	missense	probably damaging	0.99
R2049:Snx2	UTSW	18	53194444	missense	probably damaging	0.98
R2910:Snx2	UTSW	18	53199874	missense	probably damaging	0.99
R2911:Snx2	UTSW	18	53199874	missense	probably damaging	0.99
R4460:Snx2	UTSW	18	53176444	missense	probably benign	0.31
R5352:Snx2	UTSW	18	53197925	splice site	probably null
R5450:Snx2	UTSW	18	53210712	missense	probably damaging	0.99
R5576:Snx2	UTSW	18	53210750	missense	probably benign	0.33
R5965:Snx2	UTSW	18	53194462	nonsense	probably null
R6063:Snx2	UTSW	18	53209625	nonsense	probably null
R6222:Snx2	UTSW	18	53199824	nonsense	probably null
R6291:Snx2	UTSW	18	53209665	critical splice donor site	probably null
R6890:Snx2	UTSW	18	53212879	missense	probably damaging	1.00
R7380:Snx2	UTSW	18	53194568	missense	probably benign
R8081:Snx2	UTSW	18	53216387	missense	probably benign	0.13
R8363:Snx2	UTSW	18	53197864	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGACCTTGCTCTGAGTTTGG -3'
(R):5'- TTCACTCTCCAAGGTGTTACAG -3'

Sequencing Primer
(F):5'- GCCTCTAAAAGGGATGATATACTTG -3'
(R):5'- CACTCTCCAAGGTGTTACAGATAGAG -3'

Posted On

2016-07-22