Incidental Mutation 'R5226:Rufy4'
ID402596
Institutional Source Beutler Lab
Gene Symbol Rufy4
Ensembl Gene ENSMUSG00000061815
Gene NameRUN and FYVE domain containing 4
Synonyms
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74125541-74148223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74147663 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 537 (C537R)
Ref Sequence ENSEMBL: ENSMUSP00000115873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080167] [ENSMUST00000127134]
Predicted Effect probably damaging
Transcript: ENSMUST00000080167
AA Change: C453R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079062
Gene: ENSMUSG00000061815
AA Change: C453R

DomainStartEndE-ValueType
Pfam:RUN 2 81 1.5e-8 PFAM
coiled coil region 331 404 N/A INTRINSIC
Blast:FYVE 415 472 2e-6 BLAST
SCOP:d1vfya_ 428 473 4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127134
AA Change: C537R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115873
Gene: ENSMUSG00000061815
AA Change: C537R

DomainStartEndE-ValueType
Pfam:RUN 41 165 6.2e-10 PFAM
coiled coil region 415 488 N/A INTRINSIC
Blast:FYVE 499 556 2e-6 BLAST
SCOP:d1vfya_ 512 557 3e-7 SMART
Meta Mutation Damage Score 0.8605 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Rufy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Rufy4 APN 1 74129354 missense probably damaging 1.00
IGL02075:Rufy4 APN 1 74129359 missense probably damaging 1.00
IGL02604:Rufy4 APN 1 74134189 missense probably damaging 1.00
IGL02606:Rufy4 APN 1 74133350 splice site probably benign
IGL02928:Rufy4 APN 1 74129082 unclassified probably benign
R0091:Rufy4 UTSW 1 74128936 unclassified probably benign
R0507:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R0589:Rufy4 UTSW 1 74132883 missense probably damaging 1.00
R0595:Rufy4 UTSW 1 74140930 missense possibly damaging 0.94
R0742:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R1533:Rufy4 UTSW 1 74129843 critical splice donor site probably null
R1666:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1668:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1827:Rufy4 UTSW 1 74134120 missense probably damaging 1.00
R2018:Rufy4 UTSW 1 74140947 missense possibly damaging 0.49
R2095:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2306:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2307:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2472:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2475:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3022:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3054:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3055:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3056:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3118:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3237:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3545:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3546:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3547:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3548:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3768:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3770:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3816:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3817:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3818:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3819:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3895:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4050:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4091:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4124:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4125:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4127:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4231:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4233:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4234:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4254:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4255:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4319:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4320:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4321:Rufy4 UTSW 1 74132784 missense possibly damaging 0.93
R4321:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4322:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4323:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4324:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4360:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4361:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4406:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4408:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4516:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4517:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4520:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4522:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4524:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4531:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4533:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4617:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4661:Rufy4 UTSW 1 74133107 missense probably damaging 0.99
R4778:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4779:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4840:Rufy4 UTSW 1 74129039 missense possibly damaging 0.82
R4897:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4898:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4899:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4915:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4917:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4918:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4997:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5092:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5097:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5189:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5191:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5195:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5196:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5197:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5227:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5228:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5230:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5372:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5373:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5374:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5375:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5376:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5377:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5378:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5699:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5748:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5750:Rufy4 UTSW 1 74132909 missense probably benign 0.01
R5767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5865:Rufy4 UTSW 1 74146755 missense probably damaging 0.99
R6083:Rufy4 UTSW 1 74129397 missense probably damaging 0.99
R6149:Rufy4 UTSW 1 74147733 missense probably benign 0.15
R6279:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6300:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6629:Rufy4 UTSW 1 74132367 intron probably null
R6809:Rufy4 UTSW 1 74133047 missense probably benign 0.00
R7179:Rufy4 UTSW 1 74132876 missense probably benign 0.12
R7218:Rufy4 UTSW 1 74133015 missense probably damaging 0.99
R7453:Rufy4 UTSW 1 74129334 splice site probably null
X0023:Rufy4 UTSW 1 74141049 missense probably benign 0.04
X0025:Rufy4 UTSW 1 74133019 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCATCAGGAGAAGCTGC -3'
(R):5'- AGCTAGGCCTATCTGTGGAC -3'

Sequencing Primer
(F):5'- GGAGAAGCTGCCACCTCAATTAG -3'
(R):5'- TGGACTGCCAGCTGTTCC -3'
Posted On2016-07-22