Incidental Mutation 'R5226:Akr1d1'
ID402611
Institutional Source Beutler Lab
Gene Symbol Akr1d1
Ensembl Gene ENSMUSG00000038641
Gene Namealdo-keto reductase family 1, member D1
Synonyms
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location37530173-37568815 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 37536014 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040987]
Predicted Effect probably null
Transcript: ENSMUST00000040987
SMART Domains Protein: ENSMUSP00000048830
Gene: ENSMUSG00000038641

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 20 303 2.7e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123648
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is responsible for the catalysis of the 5-beta-reduction of bile acid intermediates and steroid hormones carrying a delta(4)-3-one structure. Deficiency of this enzyme may contribute to hepatic dysfunction. Three transcript variants encoding different isoforms have been found for this gene. Other variants may be present, but their full-length natures have not been determined yet. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Akr1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Akr1d1 APN 6 37530243 start gained probably benign
IGL01927:Akr1d1 APN 6 37564459 missense probably benign 0.35
IGL02376:Akr1d1 APN 6 37530285 missense probably damaging 0.99
IGL02488:Akr1d1 APN 6 37567160 missense probably benign 0.00
IGL02490:Akr1d1 APN 6 37558488 missense probably damaging 1.00
IGL02685:Akr1d1 APN 6 37530343 splice site probably benign
R0963:Akr1d1 UTSW 6 37530274 missense probably damaging 0.98
R1962:Akr1d1 UTSW 6 37536048 missense probably benign 0.01
R1985:Akr1d1 UTSW 6 37558401 missense probably damaging 1.00
R4082:Akr1d1 UTSW 6 37557489 missense probably damaging 1.00
R4736:Akr1d1 UTSW 6 37557600 critical splice donor site probably null
R4850:Akr1d1 UTSW 6 37554587 unclassified probably null
R4860:Akr1d1 UTSW 6 37564491 missense probably damaging 1.00
R4860:Akr1d1 UTSW 6 37564491 missense probably damaging 1.00
R4883:Akr1d1 UTSW 6 37558401 missense possibly damaging 0.84
R6024:Akr1d1 UTSW 6 37558482 missense probably benign 0.01
R6451:Akr1d1 UTSW 6 37550215 missense probably benign 0.06
R7538:Akr1d1 UTSW 6 37536108 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CACCAAATGAGACTGTGGAAC -3'
(R):5'- CCTCCCATCTATGGTAGCAAAC -3'

Sequencing Primer
(F):5'- AACAGTGGATTGTCATGGCG -3'
(R):5'- GGTAGCAAACATTATAGCATTCAGTG -3'
Posted On2016-07-22