Incidental Mutation 'R5226:Pdzrn3'
ID402612
Institutional Source Beutler Lab
Gene Symbol Pdzrn3
Ensembl Gene ENSMUSG00000035357
Gene NamePDZ domain containing RING finger 3
SynonymsLNX3, semaphorin cytoplasmic domain-associated protein 3A, Semcap3, 1110020C07Rik
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location101149609-101377897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101153311 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 515 (D515N)
Ref Sequence ENSEMBL: ENSMUSP00000075376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075994]
Predicted Effect probably damaging
Transcript: ENSMUST00000075994
AA Change: D515N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357
AA Change: D515N

DomainStartEndE-ValueType
RING 18 55 3.93e-3 SMART
low complexity region 198 214 N/A INTRINSIC
PDZ 257 339 3.38e-21 SMART
PDZ 429 504 3.86e-16 SMART
low complexity region 512 526 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 1020 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203474
Meta Mutation Damage Score 0.2773 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Pdzrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Pdzrn3 APN 6 101354486 missense probably benign 0.01
IGL01511:Pdzrn3 APN 6 101153256 missense possibly damaging 0.66
IGL01554:Pdzrn3 APN 6 101150541 missense probably damaging 1.00
IGL02450:Pdzrn3 APN 6 101354500 missense probably damaging 1.00
IGL02505:Pdzrn3 APN 6 101151938 missense possibly damaging 0.94
IGL03061:Pdzrn3 APN 6 101151855 missense probably damaging 1.00
IGL03210:Pdzrn3 APN 6 101156952 missense possibly damaging 0.95
gefilte UTSW 6 101154192 critical splice donor site probably null
implevit_bonis UTSW 6 101151022 missense probably benign 0.15
predisposition UTSW 6 101151053 missense probably damaging 1.00
tendency UTSW 6 101151428 missense probably damaging 1.00
PIT4581001:Pdzrn3 UTSW 6 101151503 missense probably benign 0.00
R0110:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0469:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0496:Pdzrn3 UTSW 6 101150570 missense possibly damaging 0.94
R0510:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0883:Pdzrn3 UTSW 6 101155942 splice site probably null
R1171:Pdzrn3 UTSW 6 101150877 missense probably damaging 1.00
R1471:Pdzrn3 UTSW 6 101151512 missense possibly damaging 0.77
R1496:Pdzrn3 UTSW 6 101150969 missense probably benign 0.00
R1596:Pdzrn3 UTSW 6 101151005 missense probably benign 0.03
R2033:Pdzrn3 UTSW 6 101150954 missense probably damaging 1.00
R2068:Pdzrn3 UTSW 6 101150699 missense probably damaging 1.00
R2084:Pdzrn3 UTSW 6 101154295 missense probably benign 0.35
R2432:Pdzrn3 UTSW 6 101150791 missense probably damaging 1.00
R3727:Pdzrn3 UTSW 6 101156945 missense probably damaging 0.98
R3861:Pdzrn3 UTSW 6 101172371 missense possibly damaging 0.95
R4616:Pdzrn3 UTSW 6 101152009 missense probably damaging 0.99
R4967:Pdzrn3 UTSW 6 101151590 missense probably damaging 1.00
R5224:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5227:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5230:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5320:Pdzrn3 UTSW 6 101151103 missense probably damaging 1.00
R5414:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5686:Pdzrn3 UTSW 6 101151428 missense probably damaging 1.00
R5772:Pdzrn3 UTSW 6 101172314 missense probably benign 0.00
R6026:Pdzrn3 UTSW 6 101362144 missense probably benign 0.40
R6213:Pdzrn3 UTSW 6 101377844 missense probably damaging 1.00
R6518:Pdzrn3 UTSW 6 101150514 makesense probably null
R6657:Pdzrn3 UTSW 6 101151022 missense probably benign 0.15
R6951:Pdzrn3 UTSW 6 101154192 critical splice donor site probably null
R7055:Pdzrn3 UTSW 6 101151774 nonsense probably null
R7290:Pdzrn3 UTSW 6 101151245 missense probably benign
R7608:Pdzrn3 UTSW 6 101151752 missense probably damaging 1.00
R7834:Pdzrn3 UTSW 6 101151195 missense probably damaging 0.97
R7917:Pdzrn3 UTSW 6 101151195 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCTGATGGTCGTCGGCATC -3'
(R):5'- AGAGCCTGACAATTCCTCTTTCTG -3'

Sequencing Primer
(F):5'- CGGCATCTTGGAAGGTACACATTC -3'
(R):5'- CAGCATTGTGTTCAGTCACAGAGC -3'
Posted On2016-07-22