Mutagenetix > Incidental Mutations

Incidental Mutation 'R5226:Slfn4'

402624

Institutional Source

Beutler Lab

Gene Symbol

Slfn4

Ensembl Gene

ENSMUSG00000000204

Gene Name

schlafen 4

Synonyms

MMRRC Submission

042799-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5226 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83175186-83190216 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83187549 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 388 (M388L)

Ref Sequence

ENSEMBL: ENSMUSP00000132595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000208] [ENSMUST00000019130] [ENSMUST00000167596] [ENSMUST00000214041] [ENSMUST00000215472]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000208
AA Change: M388L

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000000208
Gene: ENSMUSG00000000204
AA Change: M388L

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	243	382	1.3e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000019130

SMART Domains

Protein: ENSMUSP00000019130
Gene: ENSMUSG00000018986

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	165	303	5.5e-11	PFAM
low complexity region	394	412	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167596
AA Change: M388L

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132595
Gene: ENSMUSG00000000204
AA Change: M388L

Domain	Start	End	E-Value	Type
Pfam:AAA_4	243	385	1e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214041

Predicted Effect

probably benign
Transcript: ENSMUST00000215472

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the Schlafen family. All members of this family contain a Schlafen box domain that lies near an AAA domain. This protein belongs to the group 2 subset of Schlafen proteins, which are defined by a molecular weight between 58 kDa and 68 kDa and by the presence of a SWADL domain that contains the sequence Ser-Trp-Ala-Asp-Leu. In malignant melanoma cells, gene expression is up-regulated in response to interferon alpha. In bone marrow-derived macrophages, expression of this gene is induced during activation by Toll-like receptor agonists and repressed during macrophage colony-stimulating factor-mediated differentiation. Myelopoiesis is disrupted by constitutive overexpression in myeloid-lineage cells. A pseudogene of this gene is found on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,294,076	K98E	possibly damaging	Het
4933414I15Rik	A	T	11: 50,942,589	M62K	unknown	Het
Akr1d1	T	A	6: 37,536,014		probably null	Het
Ankrd63	T	C	2: 118,703,255		probably benign	Het
Atad5	T	C	11: 80,095,062	V325A	probably damaging	Het
Atp13a5	G	T	16: 29,248,279	N1025K	probably damaging	Het
Atrnl1	G	T	19: 57,650,335	V302L	probably benign	Het
Bend7	C	A	2: 4,752,978	S277*	probably null	Het
Btnl7-ps	A	T	17: 34,533,287		noncoding transcript	Het
Cbx4	T	C	11: 119,081,928	Y207C	probably damaging	Het
Ctla2b	C	T	13: 60,896,332	W63*	probably null	Het
Cux1	T	C	5: 136,370,173	T170A	probably benign	Het
Cyp3a57	T	C	5: 145,365,697	V101A	probably benign	Het
Dao	A	T	5: 114,021,033	T267S	probably benign	Het
Dsp	A	G	13: 38,186,770	D883G	probably damaging	Het
Eif4g3	C	A	4: 138,096,794	P36T	possibly damaging	Het
Elf3	G	A	1: 135,257,239	L70F	probably benign	Het
Epb41l4a	C	T	18: 33,810,313	D510N	probably damaging	Het
Gcn1l1	T	C	5: 115,588,067	S594P	probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gpr132	T	C	12: 112,852,148	T353A	probably benign	Het
Kntc1	A	G	5: 123,794,172	D1343G	probably benign	Het
L3mbtl4	T	A	17: 68,764,722		probably null	Het
Lrit2	A	G	14: 37,072,353	E458G	probably damaging	Het
Man1c1	A	T	4: 134,578,369	I348N	probably damaging	Het
Map4k2	A	G	19: 6,346,504		probably benign	Het
Nt5c2	A	C	19: 46,898,629	Y203D	probably damaging	Het
Oxgr1	A	G	14: 120,022,253	S181P	probably damaging	Het
Parn	A	G	16: 13,625,552	C400R	probably benign	Het
Pcdhgb7	T	C	18: 37,752,524	V249A	probably benign	Het
Pdzrn3	C	T	6: 101,153,311	D515N	probably damaging	Het
Plcg2	A	T	8: 117,577,874	I273F	possibly damaging	Het
Plin1	A	G	7: 79,722,699	V64A	probably damaging	Het
Ppfia4	C	A	1: 134,304,286		probably null	Het
Prkg2	A	C	5: 98,976,462	D376E	possibly damaging	Het
Ptgir	T	A	7: 16,908,720	I82N	probably damaging	Het
Pum2	C	T	12: 8,713,458	P205L	possibly damaging	Het
Rab26	T	A	17: 24,534,133		probably benign	Het
Recql4	T	C	15: 76,710,129	E63G	probably benign	Het
Rora	T	A	9: 69,364,141		probably benign	Het
Rp1	A	C	1: 4,348,033	M952R	probably benign	Het
Rpap3	T	A	15: 97,703,223	R44S	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc12a2	C	A	18: 57,879,020	P72T	probably damaging	Het
Slc1a3	C	T	15: 8,642,225	V416M	probably damaging	Het
Snrnp48	G	A	13: 38,205,117	A49T	probably benign	Het
Tctex1d4	A	G	4: 117,128,093	T38A	possibly damaging	Het
Tlx2	C	T	6: 83,068,930	G228D	possibly damaging	Het
Tmem132a	A	G	19: 10,867,144	V30A	possibly damaging	Het
Tnfrsf23	C	A	7: 143,685,785	L24F	possibly damaging	Het
Ubr2	A	T	17: 46,983,270	N312K	probably benign	Het
Vmn1r115	C	T	7: 20,844,244	V248I	probably damaging	Het
Vmn2r80	A	G	10: 79,194,040	T567A	probably benign	Het
Vps13c	A	G	9: 67,945,553	T2372A	probably benign	Het
Wnt10b	G	T	15: 98,776,614	H81N	probably damaging	Het
Zfp948	A	G	17: 21,588,243	T566A	probably benign	Het

Other mutations in Slfn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Slfn4	APN	11	83186974	missense	possibly damaging	0.94
IGL02455:Slfn4	APN	11	83186758	missense	probably damaging	1.00
IGL02600:Slfn4	APN	11	83187006	missense	possibly damaging	0.61
IGL03294:Slfn4	APN	11	83186574	missense	probably benign	0.00
R0277:Slfn4	UTSW	11	83186951	missense	probably damaging	0.96
R0323:Slfn4	UTSW	11	83186951	missense	probably damaging	0.96
R0477:Slfn4	UTSW	11	83188681	missense	probably benign	0.06
R1370:Slfn4	UTSW	11	83188806	missense	probably damaging	1.00
R1449:Slfn4	UTSW	11	83188993	missense	probably benign	0.00
R1757:Slfn4	UTSW	11	83185385	missense	possibly damaging	0.47
R2392:Slfn4	UTSW	11	83185422	missense	possibly damaging	0.77
R3738:Slfn4	UTSW	11	83185311	start codon destroyed	probably null	0.02
R4025:Slfn4	UTSW	11	83187214	missense	probably damaging	1.00
R4732:Slfn4	UTSW	11	83189282	unclassified	probably benign
R4733:Slfn4	UTSW	11	83189282	unclassified	probably benign
R4766:Slfn4	UTSW	11	83186821	missense	possibly damaging	0.92
R4876:Slfn4	UTSW	11	83187018	missense	probably benign	0.26
R4985:Slfn4	UTSW	11	83187207	missense	probably damaging	0.98
R5033:Slfn4	UTSW	11	83186797	missense	probably damaging	1.00
R5281:Slfn4	UTSW	11	83187199	missense	probably damaging	1.00
R5337:Slfn4	UTSW	11	83189229	missense	probably benign	0.35
R6207:Slfn4	UTSW	11	83189125	missense	possibly damaging	0.82
R6237:Slfn4	UTSW	11	83189112	missense	probably damaging	1.00
R6398:Slfn4	UTSW	11	83187174	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AAGTACACGTGCAAATTCATCG -3'
(R):5'- CTGGACAAGCACGCTGTATC -3'

Sequencing Primer
(F):5'- CGTGCAAATTCATCGAAGTGC -3'
(R):5'- GACAAGCACGCTGTATCTGATTTG -3'

Posted On

2016-07-22