Incidental Mutation 'R0415:Rad51c'
ID 40263
Institutional Source Beutler Lab
Gene Symbol Rad51c
Ensembl Gene ENSMUSG00000007646
Gene Name RAD51 paralog C
Synonyms Rad51l2
MMRRC Submission 038617-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0415 (G1)
Quality Score 185
Status Validated
Chromosome 11
Chromosomal Location 87267471-87295780 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87288481 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 234 (L234P)
Ref Sequence ENSEMBL: ENSMUSP00000007790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007790] [ENSMUST00000067692] [ENSMUST00000129400] [ENSMUST00000153073]
AlphaFold Q924H5
Predicted Effect probably damaging
Transcript: ENSMUST00000007790
AA Change: L234P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007790
Gene: ENSMUSG00000007646
AA Change: L234P

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Rad51 91 359 1.7e-32 PFAM
Pfam:AAA_25 97 298 1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000067692
AA Change: L216P

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064079
Gene: ENSMUSG00000007646
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rad51 73 341 1.9e-32 PFAM
Pfam:AAA_25 79 280 7.6e-10 PFAM
Pfam:KaiC 91 137 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129400
SMART Domains Protein: ENSMUSP00000121928
Gene: ENSMUSG00000007646

DomainStartEndE-ValueType
PDB:1PZN|G 10 125 2e-9 PDB
SCOP:d1g8ya_ 91 125 9e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153073
AA Change: L216P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122811
Gene: ENSMUSG00000007646
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rad51 73 315 3.2e-28 PFAM
Pfam:AAA_25 79 280 2.1e-10 PFAM
Pfam:KaiC 91 137 1.7e-8 PFAM
Meta Mutation Damage Score 0.1792 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. Mice carrying a null and a hypomorphic allele have partial penetrance of male and female infertility due to defects in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 24,036,048 (GRCm39) noncoding transcript Het
Acox2 A G 14: 8,243,835 (GRCm38) probably benign Het
Adgb T C 10: 10,306,811 (GRCm39) probably null Het
Adgra3 C A 5: 50,119,099 (GRCm39) probably benign Het
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ahnak A G 19: 8,990,235 (GRCm39) probably benign Het
Anapc2 A G 2: 25,168,337 (GRCm39) T159A probably damaging Het
Arfgef3 A G 10: 18,488,875 (GRCm39) probably benign Het
Atf7ip C T 6: 136,537,010 (GRCm39) S81L possibly damaging Het
Cacna1i A G 15: 80,253,031 (GRCm39) probably benign Het
Camk1 A T 6: 113,318,852 (GRCm39) Y20* probably null Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
Cd109 T A 9: 78,619,897 (GRCm39) S1380T probably benign Het
Cfap57 A T 4: 118,426,628 (GRCm39) L1107Q possibly damaging Het
Col6a4 C T 9: 105,952,279 (GRCm39) V540I probably damaging Het
Cst9 T A 2: 148,680,362 (GRCm39) probably benign Het
Cul5 C T 9: 53,578,370 (GRCm39) V73I probably benign Het
Cxcl16 T A 11: 70,349,574 (GRCm39) K84* probably null Het
Cyp2c29 T C 19: 39,317,539 (GRCm39) probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dip2c C T 13: 9,618,325 (GRCm39) probably benign Het
Dis3 A T 14: 99,324,892 (GRCm39) I513N probably damaging Het
Dnajc16 A T 4: 141,516,359 (GRCm39) L3* probably null Het
Dop1a T A 9: 86,388,555 (GRCm39) L480M probably damaging Het
Eml6 A G 11: 29,699,392 (GRCm39) V1787A possibly damaging Het
Etnk1 A G 6: 143,126,500 (GRCm39) N115S probably damaging Het
Fryl T C 5: 73,255,757 (GRCm39) Y758C probably damaging Het
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Ggnbp2 A C 11: 84,724,051 (GRCm39) probably benign Het
Gm7137 A G 10: 77,624,007 (GRCm39) probably benign Het
Gstm2 T A 3: 107,891,322 (GRCm39) Q132L probably benign Het
Habp2 T C 19: 56,306,149 (GRCm39) probably benign Het
Hectd2 T C 19: 36,562,284 (GRCm39) probably benign Het
Htr6 A G 4: 138,789,392 (GRCm39) I291T possibly damaging Het
Ighg2c T C 12: 113,251,530 (GRCm39) D199G unknown Het
Itih2 A G 2: 10,110,426 (GRCm39) probably benign Het
Kcnab2 A G 4: 152,479,593 (GRCm39) F248S probably benign Het
Kcnc4 T C 3: 107,352,749 (GRCm39) K610E probably damaging Het
Kcnk16 T A 14: 20,313,043 (GRCm39) probably null Het
Kndc1 C T 7: 139,510,037 (GRCm39) T1293I probably damaging Het
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Lrrc8d T C 5: 105,959,731 (GRCm39) L47P probably damaging Het
Lyset T A 12: 102,711,135 (GRCm39) Y119* probably null Het
Lyst T C 13: 13,886,195 (GRCm39) probably benign Het
Macrod2 G A 2: 142,052,065 (GRCm39) probably null Het
Mical2 C T 7: 111,980,235 (GRCm39) R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,759,576 (GRCm39) probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nup205 T C 6: 35,191,569 (GRCm39) probably benign Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or51e2 C T 7: 102,391,294 (GRCm39) M305I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Or8c15 A T 9: 38,121,269 (GRCm39) M305L probably benign Het
Or8g2 A G 9: 39,821,279 (GRCm39) Y60C probably damaging Het
Pard3 G A 8: 128,337,047 (GRCm39) G1221D probably damaging Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Pcsk6 C T 7: 65,683,622 (GRCm39) R746C probably damaging Het
Pif1 G A 9: 65,495,333 (GRCm39) C81Y probably benign Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plcd4 C A 1: 74,591,256 (GRCm39) S217Y probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Het
Polr2k A G 15: 36,175,602 (GRCm39) Y45C probably damaging Het
Prex1 A G 2: 166,428,619 (GRCm39) probably benign Het
Pth2r A G 1: 65,427,598 (GRCm39) M424V probably benign Het
Pygm A G 19: 6,441,396 (GRCm39) R464G probably benign Het
Rnf145 A G 11: 44,415,965 (GRCm39) Y60C probably damaging Het
Rnf167 T C 11: 70,540,525 (GRCm39) I135T probably damaging Het
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ro60 G T 1: 143,635,813 (GRCm39) N444K probably benign Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Het
Selenbp1 T C 3: 94,844,224 (GRCm39) V27A possibly damaging Het
Selenof T G 3: 144,283,453 (GRCm39) L14R probably damaging Het
Sfswap A T 5: 129,581,190 (GRCm39) D121V probably damaging Het
Slc25a34 C A 4: 141,347,780 (GRCm39) M300I possibly damaging Het
Slc34a3 T G 2: 25,119,122 (GRCm39) T583P probably benign Het
Slc66a3 C A 12: 17,047,711 (GRCm39) probably benign Het
Smg1 C A 7: 117,781,691 (GRCm39) A1199S probably benign Het
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Sptbn1 A C 11: 30,099,576 (GRCm39) N229K probably damaging Het
Sult2b1 A G 7: 45,379,516 (GRCm39) probably benign Het
Tas2r123 A T 6: 132,824,801 (GRCm39) M233L probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem132c A G 5: 127,640,769 (GRCm39) E980G probably damaging Het
Tmem247 G T 17: 87,229,750 (GRCm39) C197F probably damaging Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Het
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Ubr5 T C 15: 37,973,224 (GRCm39) T2626A probably damaging Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Het
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Het
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Vmn2r74 A C 7: 85,610,618 (GRCm39) C25G probably damaging Het
Xndc1 T C 7: 101,729,823 (GRCm39) probably benign Het
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Het
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Het
Zfp316 T A 5: 143,250,246 (GRCm39) T56S unknown Het
Zfp345 A G 2: 150,316,479 (GRCm39) probably benign Het
Other mutations in Rad51c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Rad51c APN 11 87,271,681 (GRCm39) missense possibly damaging 0.92
IGL03096:Rad51c APN 11 87,279,472 (GRCm39) missense probably damaging 1.00
IGL03493:Rad51c APN 11 87,288,579 (GRCm39) missense probably benign 0.00
R1875:Rad51c UTSW 11 87,279,469 (GRCm39) missense probably damaging 0.99
R2098:Rad51c UTSW 11 87,293,589 (GRCm39) missense probably benign
R4172:Rad51c UTSW 11 87,293,572 (GRCm39) missense probably damaging 1.00
R4798:Rad51c UTSW 11 87,286,204 (GRCm39) missense probably damaging 1.00
R5054:Rad51c UTSW 11 87,288,580 (GRCm39) missense probably benign 0.06
R5182:Rad51c UTSW 11 87,288,545 (GRCm39) missense possibly damaging 0.85
R5381:Rad51c UTSW 11 87,288,459 (GRCm39) missense probably benign 0.00
R6087:Rad51c UTSW 11 87,271,705 (GRCm39) missense probably benign 0.02
R7066:Rad51c UTSW 11 87,293,502 (GRCm39) missense possibly damaging 0.56
R7714:Rad51c UTSW 11 87,292,276 (GRCm39) missense probably benign 0.00
R8242:Rad51c UTSW 11 87,280,712 (GRCm39) missense probably damaging 1.00
R9054:Rad51c UTSW 11 87,293,542 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGCTTTGGggggctaaagagat -3'
(R):5'- CCATGTAACTGgctgaggcaagga -3'

Sequencing Primer
(F):5'- gccctgactgctcttcc -3'
(R):5'- tgtcctttcttttccactacctc -3'
Posted On 2013-05-23