Incidental Mutation 'R0415:Rad51c'
ID40263
Institutional Source Beutler Lab
Gene Symbol Rad51c
Ensembl Gene ENSMUSG00000007646
Gene NameRAD51 paralog C
SynonymsRad51l2
MMRRC Submission 038617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0415 (G1)
Quality Score185
Status Validated
Chromosome11
Chromosomal Location87376645-87404954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87397655 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 234 (L234P)
Ref Sequence ENSEMBL: ENSMUSP00000007790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007790] [ENSMUST00000067692] [ENSMUST00000129400] [ENSMUST00000153073]
Predicted Effect probably damaging
Transcript: ENSMUST00000007790
AA Change: L234P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007790
Gene: ENSMUSG00000007646
AA Change: L234P

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Rad51 91 359 1.7e-32 PFAM
Pfam:AAA_25 97 298 1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000067692
AA Change: L216P

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064079
Gene: ENSMUSG00000007646
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rad51 73 341 1.9e-32 PFAM
Pfam:AAA_25 79 280 7.6e-10 PFAM
Pfam:KaiC 91 137 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129400
SMART Domains Protein: ENSMUSP00000121928
Gene: ENSMUSG00000007646

DomainStartEndE-ValueType
PDB:1PZN|G 10 125 2e-9 PDB
SCOP:d1g8ya_ 91 125 9e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153073
AA Change: L216P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122811
Gene: ENSMUSG00000007646
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rad51 73 315 3.2e-28 PFAM
Pfam:AAA_25 79 280 2.1e-10 PFAM
Pfam:KaiC 91 137 1.7e-8 PFAM
Meta Mutation Damage Score 0.1792 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. Mice carrying a null and a hypomorphic allele have partial penetrance of male and female infertility due to defects in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 23,831,050 noncoding transcript Het
Acox2 A G 14: 8,243,835 probably benign Het
Adgb T C 10: 10,431,067 probably null Het
Adgra3 C A 5: 49,961,757 probably benign Het
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ahnak A G 19: 9,012,871 probably benign Het
Anapc2 A G 2: 25,278,325 T159A probably damaging Het
Arfgef3 A G 10: 18,613,127 probably benign Het
Atf7ip C T 6: 136,560,012 S81L possibly damaging Het
Cacna1i A G 15: 80,368,830 probably benign Het
Camk1 A T 6: 113,341,891 Y20* probably null Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
Cd109 T A 9: 78,712,615 S1380T probably benign Het
Cfap57 A T 4: 118,569,431 L1107Q possibly damaging Het
Col6a4 C T 9: 106,075,080 V540I probably damaging Het
Cst9 T A 2: 148,838,442 probably benign Het
Cul5 C T 9: 53,667,070 V73I probably benign Het
Cxcl16 T A 11: 70,458,748 K84* probably null Het
Cyp2c29 T C 19: 39,329,095 probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dip2c C T 13: 9,568,289 probably benign Het
Dis3 A T 14: 99,087,456 I513N probably damaging Het
Dnajc16 A T 4: 141,789,048 L3* probably null Het
Dopey1 T A 9: 86,506,502 L480M probably damaging Het
Eml6 A G 11: 29,749,392 V1787A possibly damaging Het
Etnk1 A G 6: 143,180,774 N115S probably damaging Het
Fryl T C 5: 73,098,414 Y758C probably damaging Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Ggnbp2 A C 11: 84,833,225 probably benign Het
Gm7137 A G 10: 77,788,173 probably benign Het
Gstm2 T A 3: 107,984,006 Q132L probably benign Het
Habp2 T C 19: 56,317,717 probably benign Het
Hectd2 T C 19: 36,584,884 probably benign Het
Htr6 A G 4: 139,062,081 I291T possibly damaging Het
Ighg2c T C 12: 113,287,910 D199G unknown Het
Itih2 A G 2: 10,105,615 probably benign Het
Kcnab2 A G 4: 152,395,136 F248S probably benign Het
Kcnc4 T C 3: 107,445,433 K610E probably damaging Het
Kcnk16 T A 14: 20,262,975 probably null Het
Kndc1 C T 7: 139,930,124 T1293I probably damaging Het
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Lrrc8d T C 5: 105,811,865 L47P probably damaging Het
Lyst T C 13: 13,711,610 probably benign Het
Macrod2 G A 2: 142,210,145 probably null Het
Micalcl C T 7: 112,381,028 R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,841,339 probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nup205 T C 6: 35,214,634 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Olfr229 A G 9: 39,909,983 Y60C probably damaging Het
Olfr78 C T 7: 102,742,087 M305I probably benign Het
Olfr893 A T 9: 38,209,973 M305L probably benign Het
Pard3 G A 8: 127,610,566 G1221D probably damaging Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Pcsk6 C T 7: 66,033,874 R746C probably damaging Het
Pif1 G A 9: 65,588,051 C81Y probably benign Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plcd4 C A 1: 74,552,097 S217Y probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Het
Polr2k A G 15: 36,175,456 Y45C probably damaging Het
Pqlc3 C A 12: 16,997,710 probably benign Het
Prex1 A G 2: 166,586,699 probably benign Het
Pth2r A G 1: 65,388,439 M424V probably benign Het
Pygm A G 19: 6,391,366 R464G probably benign Het
Rnf145 A G 11: 44,525,138 Y60C probably damaging Het
Rnf167 T C 11: 70,649,699 I135T probably damaging Het
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Het
Selenbp1 T C 3: 94,936,913 V27A possibly damaging Het
Selenof T G 3: 144,577,692 L14R probably damaging Het
Sfswap A T 5: 129,504,126 D121V probably damaging Het
Slc25a34 C A 4: 141,620,469 M300I possibly damaging Het
Slc34a3 T G 2: 25,229,110 T583P probably benign Het
Smg1 C A 7: 118,182,468 A1199S probably benign Het
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Sptbn1 A C 11: 30,149,576 N229K probably damaging Het
Sult2b1 A G 7: 45,730,092 probably benign Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem132c A G 5: 127,563,705 E980G probably damaging Het
Tmem247 G T 17: 86,922,322 C197F probably damaging Het
Tmem251 T A 12: 102,744,876 Y119* probably null Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Het
Tmprss13 A G 9: 45,337,132 probably null Het
Trove2 G T 1: 143,760,075 N444K probably benign Het
Ubr5 T C 15: 37,972,980 T2626A probably damaging Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Het
Vmn1r22 G T 6: 57,900,332 T220K probably benign Het
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Vmn2r74 A C 7: 85,961,410 C25G probably damaging Het
Xndc1 T C 7: 102,080,616 probably benign Het
Zfp282 A G 6: 47,897,881 D340G probably damaging Het
Zfp282 T A 6: 47,905,053 I558N possibly damaging Het
Zfp316 T A 5: 143,264,491 T56S unknown Het
Zfp345 A G 2: 150,474,559 probably benign Het
Other mutations in Rad51c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Rad51c APN 11 87380855 missense possibly damaging 0.92
IGL03096:Rad51c APN 11 87388646 missense probably damaging 1.00
IGL03493:Rad51c APN 11 87397753 missense probably benign 0.00
R1875:Rad51c UTSW 11 87388643 missense probably damaging 0.99
R2098:Rad51c UTSW 11 87402763 missense probably benign
R4172:Rad51c UTSW 11 87402746 missense probably damaging 1.00
R4798:Rad51c UTSW 11 87395378 missense probably damaging 1.00
R5054:Rad51c UTSW 11 87397754 missense probably benign 0.06
R5182:Rad51c UTSW 11 87397719 missense possibly damaging 0.85
R5381:Rad51c UTSW 11 87397633 missense probably benign 0.00
R6087:Rad51c UTSW 11 87380879 missense probably benign 0.02
R7066:Rad51c UTSW 11 87402676 missense possibly damaging 0.56
R7714:Rad51c UTSW 11 87401450 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCTTTGGggggctaaagagat -3'
(R):5'- CCATGTAACTGgctgaggcaagga -3'

Sequencing Primer
(F):5'- gccctgactgctcttcc -3'
(R):5'- tgtcctttcttttccactacctc -3'
Posted On2013-05-23