Incidental Mutation 'R5226:Ctla2b'
ID402631
Institutional Source Beutler Lab
Gene Symbol Ctla2b
Ensembl Gene ENSMUSG00000074874
Gene Namecytotoxic T lymphocyte-associated protein 2 beta
SynonymsCtla-2b
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location60895350-60897447 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 60896332 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 63 (W63*)
Ref Sequence ENSEMBL: ENSMUSP00000153232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021884] [ENSMUST00000080766] [ENSMUST00000171347] [ENSMUST00000223978] [ENSMUST00000225167] [ENSMUST00000225439] [ENSMUST00000225690] [ENSMUST00000225859]
Predicted Effect probably null
Transcript: ENSMUST00000021884
AA Change: W39*
SMART Domains Protein: ENSMUSP00000021884
Gene: ENSMUSG00000074874
AA Change: W39*

DomainStartEndE-ValueType
Inhibitor_I29 16 75 1.85e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080766
SMART Domains Protein: ENSMUSP00000079588
Gene: ENSMUSG00000062705

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171347
AA Change: W39*
SMART Domains Protein: ENSMUSP00000131083
Gene: ENSMUSG00000074874
AA Change: W39*

DomainStartEndE-ValueType
Inhibitor_I29 16 75 1.85e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223978
Predicted Effect probably benign
Transcript: ENSMUST00000225167
Predicted Effect probably benign
Transcript: ENSMUST00000225382
Predicted Effect probably benign
Transcript: ENSMUST00000225439
Predicted Effect probably null
Transcript: ENSMUST00000225690
AA Change: W39*
Predicted Effect probably benign
Transcript: ENSMUST00000225732
Predicted Effect probably benign
Transcript: ENSMUST00000225802
Predicted Effect probably null
Transcript: ENSMUST00000225859
AA Change: W63*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Ctla2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Ctla2b APN 13 60896689 makesense probably null
IGL03088:Ctla2b APN 13 60896060 missense probably damaging 1.00
R0179:Ctla2b UTSW 13 60896293 missense possibly damaging 0.82
R1950:Ctla2b UTSW 13 60896049 missense possibly damaging 0.91
R2001:Ctla2b UTSW 13 60896067 missense probably damaging 0.99
R3859:Ctla2b UTSW 13 60896043 missense possibly damaging 0.79
R5393:Ctla2b UTSW 13 60896132 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGCAATTTGTCCTGAATTC -3'
(R):5'- ACATGCATTATGAACCCATACTGG -3'

Sequencing Primer
(F):5'- ACAGCAATTTGTCCTGAATTCTTCTG -3'
(R):5'- CCATACTGGGTAAGGAGAATGGCTG -3'
Posted On2016-07-22